ID: 1187069673

View in Genome Browser
Species Human (GRCh38)
Location X:15875676-15875698
Sequence AGCTGTGGAAGGAGGACAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187069667_1187069673 -4 Left 1187069667 X:15875657-15875679 CCCACACAGGAAAGTAGTGAGCT No data
Right 1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG No data
1187069668_1187069673 -5 Left 1187069668 X:15875658-15875680 CCACACAGGAAAGTAGTGAGCTG No data
Right 1187069673 X:15875676-15875698 AGCTGTGGAAGGAGGACAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187069673 Original CRISPR AGCTGTGGAAGGAGGACAGA GGG Intergenic
No off target data available for this crispr