ID: 1187072872

View in Genome Browser
Species Human (GRCh38)
Location X:15905660-15905682
Sequence CAGATAAAGGAGAAAAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187072872_1187072877 17 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072877 X:15905700-15905722 GAAGTTGGTCATATAGAACTTGG No data
1187072872_1187072879 26 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072879 X:15905709-15905731 CATATAGAACTTGGGCCCCCAGG No data
1187072872_1187072875 2 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072875 X:15905685-15905707 TCCACGCATTTCACTGAAGTTGG No data
1187072872_1187072878 18 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072878 X:15905701-15905723 AAGTTGGTCATATAGAACTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187072872 Original CRISPR CAGATAAAGGAGAAAAAGGC TGG (reversed) Intergenic
No off target data available for this crispr