ID: 1187072875

View in Genome Browser
Species Human (GRCh38)
Location X:15905685-15905707
Sequence TCCACGCATTTCACTGAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187072873_1187072875 -2 Left 1187072873 X:15905664-15905686 CCTTTTTCTCCTTTATCTGCATC No data
Right 1187072875 X:15905685-15905707 TCCACGCATTTCACTGAAGTTGG No data
1187072872_1187072875 2 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072875 X:15905685-15905707 TCCACGCATTTCACTGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187072875 Original CRISPR TCCACGCATTTCACTGAAGT TGG Intergenic
No off target data available for this crispr