ID: 1187072879

View in Genome Browser
Species Human (GRCh38)
Location X:15905709-15905731
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187072872_1187072879 26 Left 1187072872 X:15905660-15905682 CCAGCCTTTTTCTCCTTTATCTG No data
Right 1187072879 X:15905709-15905731 CATATAGAACTTGGGCCCCCAGG No data
1187072874_1187072879 13 Left 1187072874 X:15905673-15905695 CCTTTATCTGCATCCACGCATTT No data
Right 1187072879 X:15905709-15905731 CATATAGAACTTGGGCCCCCAGG No data
1187072873_1187072879 22 Left 1187072873 X:15905664-15905686 CCTTTTTCTCCTTTATCTGCATC No data
Right 1187072879 X:15905709-15905731 CATATAGAACTTGGGCCCCCAGG No data
1187072876_1187072879 0 Left 1187072876 X:15905686-15905708 CCACGCATTTCACTGAAGTTGGT No data
Right 1187072879 X:15905709-15905731 CATATAGAACTTGGGCCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187072879 Original CRISPR CATATAGAACTTGGGCCCCC AGG Intergenic
No off target data available for this crispr