ID: 1187073579

View in Genome Browser
Species Human (GRCh38)
Location X:15912248-15912270
Sequence TAGTGATAGTAGAGGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187073575_1187073579 18 Left 1187073575 X:15912207-15912229 CCTAGAAAGAAAATACAGCAATT No data
Right 1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG No data
1187073573_1187073579 28 Left 1187073573 X:15912197-15912219 CCAATAAATCCCTAGAAAGAAAA No data
Right 1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG No data
1187073574_1187073579 19 Left 1187073574 X:15912206-15912228 CCCTAGAAAGAAAATACAGCAAT No data
Right 1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187073579 Original CRISPR TAGTGATAGTAGAGGGAACA GGG Intergenic
No off target data available for this crispr