ID: 1187075499

View in Genome Browser
Species Human (GRCh38)
Location X:15930273-15930295
Sequence CACTGCTTGTAGTAGTCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187075499_1187075502 0 Left 1187075499 X:15930273-15930295 CCAGCCGACTACTACAAGCAGTG No data
Right 1187075502 X:15930296-15930318 AATTTTATTCATCATCTTTTGGG No data
1187075499_1187075503 9 Left 1187075499 X:15930273-15930295 CCAGCCGACTACTACAAGCAGTG No data
Right 1187075503 X:15930305-15930327 CATCATCTTTTGGGCTCAAGAGG No data
1187075499_1187075501 -1 Left 1187075499 X:15930273-15930295 CCAGCCGACTACTACAAGCAGTG No data
Right 1187075501 X:15930295-15930317 GAATTTTATTCATCATCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187075499 Original CRISPR CACTGCTTGTAGTAGTCGGC TGG (reversed) Intergenic
No off target data available for this crispr