ID: 1187083184

View in Genome Browser
Species Human (GRCh38)
Location X:16013001-16013023
Sequence ATCTACTTCTTCAGGTTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187083184_1187083187 5 Left 1187083184 X:16013001-16013023 CCATCAAACCTGAAGAAGTAGAT No data
Right 1187083187 X:16013029-16013051 TTAGAGTAGTTGAGTATTCTGGG No data
1187083184_1187083186 4 Left 1187083184 X:16013001-16013023 CCATCAAACCTGAAGAAGTAGAT No data
Right 1187083186 X:16013028-16013050 TTTAGAGTAGTTGAGTATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187083184 Original CRISPR ATCTACTTCTTCAGGTTTGA TGG (reversed) Intergenic
No off target data available for this crispr