ID: 1187083314

View in Genome Browser
Species Human (GRCh38)
Location X:16014695-16014717
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187083312_1187083314 26 Left 1187083312 X:16014646-16014668 CCTAACAATCATGATGGTAGGGA No data
Right 1187083314 X:16014695-16014717 GACTTGATAATTATTAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187083314 Original CRISPR GACTTGATAATTATTAAAAC TGG Intergenic