ID: 1187090737

View in Genome Browser
Species Human (GRCh38)
Location X:16093823-16093845
Sequence TCACTACTGTTCTCAGCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187090726_1187090737 9 Left 1187090726 X:16093791-16093813 CCCATTAACCAGCTCCGCCTCCT No data
Right 1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG No data
1187090730_1187090737 -8 Left 1187090730 X:16093808-16093830 CCTCCTTCCCCCTCCTCACTACT No data
Right 1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG No data
1187090727_1187090737 8 Left 1187090727 X:16093792-16093814 CCATTAACCAGCTCCGCCTCCTT No data
Right 1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG No data
1187090729_1187090737 -5 Left 1187090729 X:16093805-16093827 CCGCCTCCTTCCCCCTCCTCACT No data
Right 1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG No data
1187090728_1187090737 1 Left 1187090728 X:16093799-16093821 CCAGCTCCGCCTCCTTCCCCCTC No data
Right 1187090737 X:16093823-16093845 TCACTACTGTTCTCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187090737 Original CRISPR TCACTACTGTTCTCAGCCTC TGG Intergenic
No off target data available for this crispr