ID: 1187091262

View in Genome Browser
Species Human (GRCh38)
Location X:16099277-16099299
Sequence GTTTTTAAGTGTATTTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187091262_1187091265 -3 Left 1187091262 X:16099277-16099299 CCCACCAAAATACACTTAAAAAC No data
Right 1187091265 X:16099297-16099319 AACCCTGCCTTTGAATTCTCAGG No data
1187091262_1187091266 -2 Left 1187091262 X:16099277-16099299 CCCACCAAAATACACTTAAAAAC No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187091262 Original CRISPR GTTTTTAAGTGTATTTTGGT GGG (reversed) Intergenic
No off target data available for this crispr