ID: 1187091266

View in Genome Browser
Species Human (GRCh38)
Location X:16099298-16099320
Sequence ACCCTGCCTTTGAATTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187091254_1187091266 30 Left 1187091254 X:16099245-16099267 CCAATCAGTTGTTCCAGTTCCCC No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091264_1187091266 -6 Left 1187091264 X:16099281-16099303 CCAAAATACACTTAAAAACCCTG No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091256_1187091266 11 Left 1187091256 X:16099264-16099286 CCCCACCCCGCTGCCCACCAAAA No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091262_1187091266 -2 Left 1187091262 X:16099277-16099299 CCCACCAAAATACACTTAAAAAC No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091258_1187091266 9 Left 1187091258 X:16099266-16099288 CCACCCCGCTGCCCACCAAAATA No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091260_1187091266 5 Left 1187091260 X:16099270-16099292 CCCGCTGCCCACCAAAATACACT No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091255_1187091266 17 Left 1187091255 X:16099258-16099280 CCAGTTCCCCACCCCGCTGCCCA No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091257_1187091266 10 Left 1187091257 X:16099265-16099287 CCCACCCCGCTGCCCACCAAAAT No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091259_1187091266 6 Left 1187091259 X:16099269-16099291 CCCCGCTGCCCACCAAAATACAC No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091263_1187091266 -3 Left 1187091263 X:16099278-16099300 CCACCAAAATACACTTAAAAACC No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data
1187091261_1187091266 4 Left 1187091261 X:16099271-16099293 CCGCTGCCCACCAAAATACACTT No data
Right 1187091266 X:16099298-16099320 ACCCTGCCTTTGAATTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187091266 Original CRISPR ACCCTGCCTTTGAATTCTCA GGG Intergenic
No off target data available for this crispr