ID: 1187092934

View in Genome Browser
Species Human (GRCh38)
Location X:16116538-16116560
Sequence GCCATTTTGTCCCATAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187092929_1187092934 1 Left 1187092929 X:16116514-16116536 CCCATAGTCTGGGGGTGCATCCC No data
Right 1187092934 X:16116538-16116560 GCCATTTTGTCCCATAAAGCTGG No data
1187092930_1187092934 0 Left 1187092930 X:16116515-16116537 CCATAGTCTGGGGGTGCATCCCG No data
Right 1187092934 X:16116538-16116560 GCCATTTTGTCCCATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187092934 Original CRISPR GCCATTTTGTCCCATAAAGC TGG Intergenic
No off target data available for this crispr