ID: 1187094629

View in Genome Browser
Species Human (GRCh38)
Location X:16134408-16134430
Sequence AAATAGAAACAGATTTATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 775
Summary {0: 1, 1: 0, 2: 7, 3: 58, 4: 709}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187094629_1187094631 16 Left 1187094629 X:16134408-16134430 CCTCTATAAATCTGTTTCTATTT 0: 1
1: 0
2: 7
3: 58
4: 709
Right 1187094631 X:16134447-16134469 AGATAATTTGAGGCTCTAGATGG 0: 1
1: 0
2: 1
3: 14
4: 129
1187094629_1187094630 6 Left 1187094629 X:16134408-16134430 CCTCTATAAATCTGTTTCTATTT 0: 1
1: 0
2: 7
3: 58
4: 709
Right 1187094630 X:16134437-16134459 CAAGAATTATAGATAATTTGAGG 0: 1
1: 0
2: 4
3: 27
4: 372

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187094629 Original CRISPR AAATAGAAACAGATTTATAG AGG (reversed) Intronic
904016611 1:27426302-27426324 ATATAGGAACAGATTTAAGGGGG + Intronic
904443313 1:30546847-30546869 AAATGTAAACAGATTTGTAAAGG + Intergenic
905084755 1:35362867-35362889 AATTAAAAAAAGATTTGTAGAGG + Intronic
905115060 1:35631557-35631579 AAACAGAACCAGTTCTATAGTGG + Intronic
905221069 1:36448134-36448156 ATGGAGAAACAGGTTTATAGAGG + Intronic
905840155 1:41169802-41169824 AAAAAGCAGCAGATTTATACGGG - Intronic
906447658 1:45917263-45917285 AAAAAGAAACATATTCAAAGTGG - Intronic
907191391 1:52651914-52651936 AAGTAGTAACAGATCTAGAGAGG + Intronic
907690119 1:56655956-56655978 TAATAGAAACAGGTTTGTAGGGG + Intronic
907714305 1:56913145-56913167 GAAGAGAAACAGAGTTATAGAGG - Intronic
908291561 1:62671664-62671686 AAATAGAAAAATATTTGCAGGGG + Intronic
908307945 1:62843884-62843906 AAATAGAAATAAATTGATAGAGG + Intronic
908317829 1:62950984-62951006 TATTAAAAACAAATTTATAGAGG - Intergenic
908616316 1:65926870-65926892 TAATAAAAACAGACATATAGAGG + Intronic
908775358 1:67634343-67634365 ATAAAGAAACAGATTCAGAGAGG - Intergenic
908993751 1:70127170-70127192 AAGCAGAAACAGTTTTATAAAGG - Intronic
909077566 1:71069732-71069754 AAATAGAAGGGGATTTATAAAGG - Intronic
909142631 1:71888174-71888196 AAAAAGAAACTGATTTAGAATGG + Intronic
909262316 1:73506844-73506866 GAATAAAAATAGATTTAAAGAGG + Intergenic
909721052 1:78769916-78769938 AAATAGTAACAGTCTTATATTGG + Intergenic
909756807 1:79236808-79236830 AAATAAAAACAGATATTTTGAGG - Intergenic
909774945 1:79472105-79472127 AACTAAAAATAGATTTATAATGG - Intergenic
910221756 1:84895077-84895099 ACAGAGAAACAGATTCAGAGAGG + Intergenic
911132931 1:94408993-94409015 AAAAAGGAACAGATTGATAAGGG - Intergenic
911545292 1:99208966-99208988 AAATAGAAACAAGCTTATGGAGG - Intergenic
911768586 1:101710280-101710302 AAATAAAAACAGAGTGATATAGG - Intergenic
911828707 1:102522947-102522969 AAATAGCAATAATTTTATAGTGG + Intergenic
911999165 1:104808728-104808750 AAATAGAGATATATATATAGAGG + Intergenic
912125047 1:106526054-106526076 AAACTGACACACATTTATAGAGG - Intergenic
912686480 1:111771219-111771241 AAAATGAAACAGCTTTAAAGGGG - Intronic
914600741 1:149202418-149202440 AAATAGGGGCAGATTTGTAGGGG + Intergenic
915999727 1:160603811-160603833 AAATAGGAACACAATAATAGTGG - Intergenic
916055906 1:161068911-161068933 AAAGAGAAACAGGTTCAAAGTGG - Intronic
916142760 1:161713415-161713437 ATAAAGAATCAGATTTATTGGGG - Exonic
916300721 1:163270944-163270966 AAATAGATACAGCTTTGTTGAGG + Intronic
916364527 1:164009714-164009736 AAATAGGCACAAAATTATAGAGG - Intergenic
917206211 1:172573031-172573053 AAAAAAAAACAGCTTTATTGGGG + Intronic
917241817 1:172956763-172956785 GAATAGAAACAGAGATTTAGTGG - Intergenic
917947180 1:179986534-179986556 ATATAGTTACAGACTTATAGGGG + Intronic
918540636 1:185628189-185628211 AAAAAGAAAAAGAGTTAAAGGGG + Intergenic
919006487 1:191905718-191905740 AAATAAAAACAAATTCATAGTGG - Intergenic
919014457 1:192013779-192013801 GAAAATAAACAGATTTCTAGTGG + Intergenic
919120244 1:193330838-193330860 AAATAAAATCAGATTGATATAGG - Intergenic
919882892 1:201912424-201912446 ACAAAGAAACAGAGTGATAGGGG - Intronic
920993257 1:210960469-210960491 AAATGCAAACTGATCTATAGTGG - Intronic
921430940 1:215065179-215065201 AAATGGAACAAGATTTTTAGGGG + Intronic
921763074 1:218939700-218939722 CAAAAGAAAAAGGTTTATAGTGG - Intergenic
921795409 1:219337997-219338019 AAACACAAACAGATTCTTAGAGG - Intergenic
922084023 1:222328191-222328213 ATATAGAACTAGATTTGTAGAGG - Intergenic
922185543 1:223271063-223271085 AAATAAAAACACATTTATCAAGG + Intronic
922521964 1:226261035-226261057 AAATATGATCAGATTGATAGAGG + Intronic
923184064 1:231552476-231552498 AAATGAAATCAGATTTATATTGG - Intronic
923326353 1:232883726-232883748 AAGTAGAAGCAGTTTTAAAGTGG - Intergenic
924841650 1:247716451-247716473 AAAGAAAAACAGAGATATAGAGG - Intergenic
924876752 1:248114253-248114275 ACACAGACACAGATTTATACTGG - Intergenic
1063318927 10:5034118-5034140 AAATAAATACAAATTTATATTGG - Intronic
1063633350 10:7755657-7755679 ATATAGAAGCAGCTTTATTGTGG - Exonic
1063648128 10:7906508-7906530 AAATACAAAAAGATTTAGGGTGG + Intronic
1064472510 10:15651052-15651074 AAATTTAAACAGATTCTTAGTGG - Intronic
1064879764 10:20037822-20037844 AAATGGAAACTGTTTTATAATGG + Intronic
1065088200 10:22202051-22202073 AAAAATAAACAGGTTTAAAGGGG - Intergenic
1065497456 10:26343933-26343955 AGAAAGATACAGGTTTATAGAGG + Intergenic
1065636323 10:27739188-27739210 AAATATAAACAGCTTTATTGTGG - Intronic
1065646482 10:27840177-27840199 AAATAGAAAAAAATGTACAGAGG - Intronic
1065648221 10:27859318-27859340 CCATAAAAACAGATTTATAATGG + Intronic
1066322507 10:34318322-34318344 AAATACAATGAGAATTATAGGGG + Intronic
1066323255 10:34327112-34327134 CAATAGAAACTGATTTATCATGG + Intronic
1067822256 10:49540446-49540468 AAGTAAAAGCAGATATATAGTGG + Intergenic
1068104241 10:52593270-52593292 AAATACAAACCGATTGATATAGG - Intergenic
1068301980 10:55155667-55155689 AAACAGAAACATAATTATTGGGG + Intronic
1068584101 10:58777198-58777220 AATCAGAAACAGAGTTATGGGGG - Intronic
1068893822 10:62177998-62178020 AAATAAAAACACATTGATGGAGG + Intergenic
1069000351 10:63256298-63256320 AAATAGCAACAGATATGTACTGG + Intronic
1069178486 10:65325668-65325690 AAATAGTAAATGATTTTTAGGGG - Intergenic
1069534438 10:69242456-69242478 AAATTCAAACAGCTTTATTGAGG + Intronic
1070227047 10:74519046-74519068 AAAAAGAAACAGCTTAATAATGG + Intronic
1070316270 10:75316075-75316097 AAATATTAACAGATCTAAAGGGG + Intergenic
1070510282 10:77154640-77154662 ATAGAGATACAGATATATAGAGG + Intronic
1071036148 10:81248126-81248148 AAATAAAAATAAATTTAAAGAGG - Intergenic
1071058412 10:81539502-81539524 AAATAGCAACACAGTAATAGTGG + Intergenic
1071162349 10:82763433-82763455 AAATAGCAATAGAATTATAGAGG + Intronic
1071319573 10:84440401-84440423 CATTAGAAACAAATTTAAAGAGG - Intronic
1072459755 10:95608259-95608281 AAATAGCAACATATTTTTAAGGG - Intronic
1072616500 10:97052629-97052651 AAAAAGAAACAGCTCTATTGAGG - Intronic
1072703478 10:97662239-97662261 AAATTAAAACAGATCTGTAGGGG - Intronic
1072826833 10:98615225-98615247 AAAAAGAAACAGAGGTCTAGAGG + Intronic
1072841197 10:98775850-98775872 AAAAAGAAACAGATTTATTGGGG - Intronic
1073103931 10:101021629-101021651 AAGAAGAAACAGGTTTAGAGAGG - Intronic
1073383199 10:103097595-103097617 AATTATACACATATTTATAGGGG + Intronic
1073623895 10:105076444-105076466 AGAGAGAAACAGGTTTATAAAGG - Intronic
1073817781 10:107226138-107226160 AAATAGAAACTGACTTAGAAAGG - Intergenic
1074000137 10:109363827-109363849 TTATAGAAACAGCTTTATCGAGG - Intergenic
1074661639 10:115665597-115665619 AGATAGCAACAGATTTAAATTGG - Intronic
1075282427 10:121151271-121151293 AAATTGAAACAGATCAATAGTGG - Intergenic
1075350569 10:121720973-121720995 AAATAATAATAGATTTATATAGG + Intergenic
1076164990 10:128274435-128274457 AAATAGAAACATATTAGTAAAGG + Intergenic
1076315954 10:129541748-129541770 AAATACAAAAAGTTTTAAAGTGG - Intronic
1076367434 10:129931051-129931073 ATATAGATACAGATATATGGGGG - Intronic
1076938847 10:133586715-133586737 AAATAAAAAGAGCTTTATTGAGG + Intergenic
1077223640 11:1428245-1428267 AAATAGCAACAGAGTCACAGAGG - Intronic
1077957190 11:7033590-7033612 TAATACAAACAGTTTTAAAGTGG + Intronic
1078665407 11:13320841-13320863 TAATAGGAACTGATTAATAGAGG + Intronic
1078827199 11:14940538-14940560 ATATAGAAAGAGATTTATGAGGG + Intronic
1079173422 11:18117437-18117459 ATATATATACAGATATATAGTGG - Intronic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1079442484 11:20529148-20529170 AAATAGAAACGTAGTTAGAGAGG + Intergenic
1079667602 11:23126421-23126443 AAATAGAAACAAAATTGTGGAGG + Intergenic
1079892743 11:26078132-26078154 AAATAGAAACGTGTTTATGGTGG + Intergenic
1080119627 11:28662346-28662368 AAAGAGAAACAGGTTTGGAGGGG - Intergenic
1080226921 11:29972395-29972417 AATTATAAACAGATTTCCAGAGG - Intergenic
1081407595 11:42715850-42715872 AAATTGAAAAAGAGTTTTAGAGG - Intergenic
1081471825 11:43381044-43381066 AAAGAGAAAGAGATTTAAATTGG + Intronic
1082965332 11:58961113-58961135 AAATAAAAAAATATATATAGGGG - Intronic
1083233598 11:61338297-61338319 ATGTAGAAACAGATTCAGAGAGG - Intronic
1086285805 11:85249378-85249400 AAATACATACAGATATATATAGG - Intronic
1086554952 11:88098330-88098352 AAATAAACACAGACTTAGAGAGG - Intergenic
1086825974 11:91497166-91497188 AAAAAGAAATAGATTTATATGGG + Intergenic
1086978714 11:93168948-93168970 AAATAGAAATGAAATTATAGAGG + Intronic
1087383375 11:97437909-97437931 AGATAGGAACAGATCTACAGAGG + Intergenic
1087414447 11:97835898-97835920 AAATAGAAAAAAATATATATAGG + Intergenic
1087553427 11:99682321-99682343 AAATAGAAAGATATTAATTGTGG + Intronic
1087585957 11:100121958-100121980 ACATAGAGACAGATGTATACGGG + Intronic
1087913426 11:103779903-103779925 AAATATACATAGATTTATATAGG - Intergenic
1087993509 11:104775489-104775511 AAATACAAAAAGTTATATAGTGG + Intergenic
1088324563 11:108588351-108588373 AAATAGCAAGAGATTTAAAGTGG + Intronic
1088580762 11:111313822-111313844 AAAAAGAAAAAAATTTATTGAGG - Intergenic
1088584165 11:111345932-111345954 AAGAAGAAACAGACTTAAAGAGG - Intergenic
1089157658 11:116414654-116414676 TATTAGAAACATATTTATAGTGG + Intergenic
1089433319 11:118439673-118439695 AAATAGGATCATATTTATAAGGG + Intronic
1090536981 11:127653558-127653580 AAATAGAAAAATGCTTATAGAGG + Intergenic
1090640256 11:128723891-128723913 AGTCAGGAACAGATTTATAGAGG + Intronic
1090679004 11:129032765-129032787 AAATAGAAAGAGACTTAAATAGG + Intronic
1091485763 12:886170-886192 AGTTAGAAACATATTTATAAAGG + Intronic
1091511892 12:1135491-1135513 AGGTAGACACAGATTTATGGAGG - Intronic
1091944291 12:4521449-4521471 CAACAGAAACAGATTTAGAAAGG + Intronic
1092014441 12:5146203-5146225 AAACAAAAACAAATTGATAGTGG - Intergenic
1092036586 12:5340982-5341004 AAATAGGAACACTTTTATACTGG + Intergenic
1092917976 12:13205517-13205539 TAATAAACACAGAATTATAGAGG - Intronic
1094469630 12:30791690-30791712 ATATAAAAACAGAATTAGAGAGG - Intergenic
1095303660 12:40615587-40615609 AAATGGAAGCATATTTATTGGGG - Intergenic
1095326891 12:40905401-40905423 AAAAAGAAACAGATAAATAAAGG - Intronic
1095493546 12:42761083-42761105 AAAAAAAAAAAGCTTTATAGTGG - Intergenic
1096293231 12:50360378-50360400 AAAAAAAAACAGCTTTATTGAGG - Intronic
1097355584 12:58597322-58597344 AGGTAGAAGCAGATTTATAGAGG - Intronic
1097392945 12:59038102-59038124 AAATAGAAACTTATTTTTAAGGG + Intergenic
1097720466 12:63014514-63014536 AAATATAAACACAGTTATTGAGG - Intergenic
1097810437 12:64013227-64013249 AACTGGAAACATATTTAAAGTGG + Intronic
1097979974 12:65728577-65728599 AAAAAGAAACAGACATAAAGGGG + Intergenic
1098566702 12:71945313-71945335 AAATAAAAACAGATGTAAAAGGG - Intronic
1098913364 12:76232876-76232898 CAATAGAAACATATTTATTATGG - Intergenic
1098946590 12:76596494-76596516 AAATAATACCAGATTTATGGAGG + Intergenic
1098973827 12:76881251-76881273 ATAAAGAAACAGATGCATAGAGG - Intergenic
1099321621 12:81157822-81157844 AAATATAAACAGAAATATAGAGG + Intronic
1099593650 12:84628540-84628562 AAATAGAAAAAAGTTTAAAGAGG + Intergenic
1099708817 12:86193378-86193400 AAATAAAAATAAATTAATAGTGG - Intronic
1099828179 12:87806206-87806228 AAATAGATATATATTTATATGGG + Intergenic
1099828335 12:87807920-87807942 AAATAAAACCAAATTTATAAAGG + Intergenic
1099852218 12:88115132-88115154 AAAAAGAAAGAGATTTAGAAAGG - Exonic
1099910009 12:88818963-88818985 AAATAGAGACAGATTAGTATTGG + Intergenic
1101008168 12:100422669-100422691 AAAGAAAAACAGATTTATTGGGG - Intergenic
1101764186 12:107683074-107683096 AAAAAGAGACAGATTTAGGGTGG - Intergenic
1102112965 12:110379017-110379039 AAATAGAAACAAATTTAGCCAGG - Intronic
1103203999 12:119114024-119114046 TATTAAAAACAGAGTTATAGAGG - Intronic
1104798468 12:131536665-131536687 ATTTAGAAGCAGATTCATAGGGG - Intergenic
1105754740 13:23453952-23453974 AAATATAGACAGATTTATTATGG + Intergenic
1106783678 13:33086380-33086402 AAATAGAAACAGTCTTTTTGAGG + Intergenic
1106899953 13:34345093-34345115 AAATAAAATCAGATGCATAGGGG - Intergenic
1107583325 13:41816036-41816058 GAATAGGAACAGATTTAAAATGG + Intronic
1107760504 13:43673273-43673295 AAATTAAAACAGATTGATGGAGG + Intronic
1107802495 13:44121963-44121985 AAATAGAAACAAATTTTTACTGG - Intergenic
1108120050 13:47175774-47175796 AACAGGAAACACATTTATAGTGG + Intergenic
1108329539 13:49371498-49371520 GAATAGAAAAAGATTATTAGAGG + Intronic
1109070416 13:57758954-57758976 AAATAGTGACAGAATTAAAGTGG - Intergenic
1109207580 13:59499332-59499354 AAAAAGAAACCGATTTAAACTGG + Intergenic
1109858065 13:68159472-68159494 AAATATAAGCAGATTTGAAGGGG - Intergenic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110528799 13:76572192-76572214 AAAAAGAAAAGGATTTAAAGAGG + Intergenic
1110553662 13:76834640-76834662 AAAAAGAAAAAGATTTAAAAAGG + Intergenic
1110758700 13:79206222-79206244 AAATAGCAACAGTTTTTTAATGG + Intergenic
1110798169 13:79664522-79664544 AAATAGAATCTGATTCAAAGAGG + Intergenic
1110936176 13:81292228-81292250 ACATTGAAACAGAGTTCTAGAGG + Intergenic
1112039554 13:95533218-95533240 AAAAAAAAAAAGATTGATAGAGG + Intronic
1112055216 13:95684533-95684555 AAAGAAAAACCCATTTATAGGGG + Intronic
1112068683 13:95823376-95823398 AAATAGCAACACAATAATAGTGG - Intronic
1112215782 13:97430581-97430603 TAATAGAAACAAATTAGTAGAGG - Intergenic
1113138118 13:107116597-107116619 AACTAGTAAAAGATTTGTAGAGG - Intergenic
1114420728 14:22580512-22580534 AAATAGAAAACTATTAATAGTGG + Intronic
1114720647 14:24877871-24877893 AAATAGATATAGATTTCTGGTGG - Intronic
1114902203 14:27077112-27077134 TAATAGAAACACATTCATACAGG - Intergenic
1114922687 14:27353258-27353280 AAGTAGATACAGATTTACACAGG + Intergenic
1115173213 14:30531820-30531842 AAATGTAAACAAATCTATAGTGG + Intergenic
1115197580 14:30818012-30818034 AAATAGACACAAATATATTGTGG + Intergenic
1115558601 14:34562825-34562847 TAAAATAAACAGAGTTATAGAGG + Exonic
1115782506 14:36785258-36785280 AAATAGAATCAGAATTCTATGGG - Intronic
1115922002 14:38385330-38385352 AAAAAAAAACATATTTATTGAGG - Intergenic
1116190869 14:41663932-41663954 AACTAGAAATAGACTTATATTGG + Intronic
1116210978 14:41943409-41943431 AAATATAAACAGATAAACAGTGG + Intergenic
1116294978 14:43096157-43096179 CAATAGAAACATATTTAAAAAGG + Intergenic
1116297488 14:43131663-43131685 AAAGAGAAACACATTGATGGAGG - Intergenic
1116328011 14:43558666-43558688 TAATAGACACATATTTATAAGGG + Intergenic
1116429878 14:44833993-44834015 AACTACAAAAAGATTTAAAGTGG + Intergenic
1116620457 14:47196529-47196551 TAATATAAACAGATGAATAGTGG + Intronic
1118491116 14:66261291-66261313 GCATAAAAACAGATGTATAGAGG - Intergenic
1119088992 14:71762892-71762914 GAATAGAAACATATTTATTTAGG + Intergenic
1119898025 14:78237390-78237412 AGATACAAACAGATTTCTAGTGG - Intergenic
1120351649 14:83368272-83368294 AAATAAAAACAGTTTTATGGAGG - Intergenic
1120358738 14:83467428-83467450 CAATATTAACAGATTTCTAGTGG - Intergenic
1120506906 14:85364224-85364246 GAAAAGAAAAACATTTATAGAGG + Intergenic
1120801897 14:88699317-88699339 AAATAGAAAGAGATAAAAAGGGG + Intronic
1121197961 14:92091633-92091655 TAAAAAAAACAGATTTATTGGGG + Intronic
1121475511 14:94197758-94197780 AAATACAAACTGAACTATAGTGG - Intronic
1121771562 14:96547748-96547770 AAATAGAAACATTTTAATAAAGG - Intronic
1121855316 14:97263974-97263996 AAATAGAAAAATGCTTATAGAGG + Intergenic
1122181177 14:99955885-99955907 AAATAGAAAGAGATTTATTATGG - Intergenic
1122193113 14:100063553-100063575 AAATAGTGACAGAATTAAAGAGG + Intronic
1122358544 14:101140906-101140928 AAATATAAAAAGAGTTAGAGTGG - Intergenic
1122849138 14:104517236-104517258 AAATAGAAGCAAATTTGGAGAGG - Intronic
1123673410 15:22683887-22683909 ACATAGACACAGAAATATAGAGG + Intergenic
1123861035 15:24467017-24467039 AGATAGATAGAGATTTTTAGGGG + Intergenic
1124096138 15:26650439-26650461 AAAGAGAAGCAGATTTTCAGAGG + Intronic
1124325414 15:28756872-28756894 ACATAGACACAGAAATATAGAGG + Intergenic
1124443058 15:29703492-29703514 AAATAGAAATAGTTATATAAAGG + Intronic
1124716605 15:32068860-32068882 AAAAAGAGACAGAATTAAAGGGG + Intronic
1125036072 15:35125203-35125225 AAATAAAAACTGATTTAAACTGG + Intergenic
1125086602 15:35737544-35737566 AAATAGAAAGAGATTTGAATAGG - Intergenic
1125292838 15:38168669-38168691 AAATAGAAACAGATTGTTCAGGG + Intergenic
1125917883 15:43505650-43505672 AATTAGAAAAATATTTATTGTGG + Intronic
1126232276 15:46341282-46341304 ATACAGAAGCAGATTTATTGGGG + Intergenic
1126416423 15:48422277-48422299 AAATATAAAGAGATCTTTAGGGG + Intronic
1126490821 15:49233543-49233565 AAACAGAAAGAGATTTTGAGAGG - Intronic
1126510911 15:49472965-49472987 AATTATAAACAGAATTAAAGTGG + Intronic
1126904306 15:53347812-53347834 AAATAGCACCAGACTTACAGTGG - Intergenic
1127183525 15:56451948-56451970 AAATATCAACAGATTTTCAGAGG - Intronic
1127742342 15:61923850-61923872 AAAAAAAAAAAGATTTAGAGGGG - Intronic
1127824593 15:62691839-62691861 AAAAAAAAAAAAATTTATAGAGG + Intronic
1127993791 15:64140378-64140400 AAATTGTCCCAGATTTATAGCGG + Intronic
1128453924 15:67822428-67822450 AAGTAGAGACAGATTGAGAGAGG + Intronic
1130405387 15:83596082-83596104 AATTAGAAACAATTTTAAAGAGG - Intronic
1131320105 15:91380623-91380645 AAATAGAAAGATATTGATAAAGG + Intergenic
1131447017 15:92507816-92507838 TAATAGAAACATTTTTATTGTGG + Intergenic
1131777185 15:95815368-95815390 AAATAGGAACAGTTTTCTAAGGG - Intergenic
1133843576 16:9433077-9433099 AAATACAAATAGATCTAAAGGGG - Intergenic
1135159072 16:20077571-20077593 AAATATATACAGAATTTTAGAGG + Intergenic
1135405924 16:22197771-22197793 AAAGCAACACAGATTTATAGTGG - Intergenic
1136011421 16:27365872-27365894 AGTTAGCAACAGATCTATAGTGG + Intergenic
1136749404 16:32619570-32619592 AAATAGTATCACATTTATTGAGG + Intergenic
1137886848 16:52114046-52114068 AAATAGAAACAAGTTGATATTGG + Intergenic
1138165448 16:54797240-54797262 ATATAGAAAGAGATTTATTGTGG + Intergenic
1138269935 16:55688487-55688509 AAATTAATGCAGATTTATAGTGG + Intronic
1138474464 16:57262736-57262758 AAATAGAAAAAAATTTAAAAAGG + Intronic
1139315517 16:66064790-66064812 AAAAAGAAAATGATTTAGAGAGG - Intergenic
1140205073 16:72927054-72927076 ATATGGAAATAGATTTTTAGAGG - Intronic
1140710987 16:77677418-77677440 GAGTAGAAAAATATTTATAGAGG + Intergenic
1203051536 16_KI270728v1_random:878784-878806 AAATAGTATCACATTTATTGAGG + Intergenic
1143044687 17:4068169-4068191 AAATAGAAAAACATTCATAAAGG + Intronic
1144860999 17:18302044-18302066 AGATAGAAAAAGGTTTATTGTGG + Intronic
1145115584 17:20207870-20207892 AATCAGAAACAGATTAATAGTGG - Intronic
1145725142 17:27114026-27114048 AAACAGAAACATAATTATTGGGG - Intergenic
1145856529 17:28164057-28164079 AAGTAGAAACATATTTAAAAGGG + Intronic
1146014976 17:29225631-29225653 AACAAGAAACAGACTGATAGGGG + Intergenic
1146598933 17:34195712-34195734 AAAAAAAAACAGCTTTATTGAGG + Intergenic
1146613601 17:34332330-34332352 AAAAAAAAAGAGATTCATAGCGG - Intergenic
1147057841 17:37847785-37847807 AAAAAGAAACAGCCTTATTGAGG + Intergenic
1147061227 17:37880274-37880296 AAAAAAAAAAAGAATTATAGTGG - Intergenic
1147506431 17:41022084-41022106 AAAGAGAAACAGAGATATAGTGG - Intergenic
1148410514 17:47462719-47462741 AAAAAAAAAAAGAATTATAGTGG - Intergenic
1149236491 17:54596415-54596437 AAAAAACAACAGATTTATATGGG + Intergenic
1149819767 17:59764752-59764774 AAAAAAAATCAGATTTATTGAGG - Intronic
1149916206 17:60612046-60612068 AAAAGAAAACAGATTTATAGAGG + Intronic
1150950129 17:69794231-69794253 AAACACAGAAAGATTTATAGTGG + Intergenic
1150952008 17:69813566-69813588 AAAAAGAAACAGATAGACAGAGG + Intergenic
1152032932 17:77854899-77854921 AGAAACAAAAAGATTTATAGGGG + Intergenic
1152054354 17:78011388-78011410 AAATAAAAACTCTTTTATAGTGG - Intronic
1153149212 18:2070912-2070934 AAATGGAAACAAATCTACAGAGG - Intergenic
1153357374 18:4152177-4152199 AAATAGAAACAGACCTTTACAGG - Intronic
1153851781 18:9102296-9102318 ATGTAGAATAAGATTTATAGTGG + Intergenic
1153975621 18:10266259-10266281 AAATATAAATAGATTTTAAGTGG - Intergenic
1154488544 18:14900187-14900209 AATTATAAACAGAATTAAAGTGG - Intergenic
1155277662 18:24204541-24204563 AAAAAGAAACAGCTTTAGGGTGG - Intronic
1155361005 18:25002644-25002666 AAATAGAAACTCTTTTATTGAGG + Intergenic
1155397623 18:25403295-25403317 AAAAAGAATCAGGTTTATGGTGG - Intergenic
1155609860 18:27654246-27654268 AAAAAAAAACAGTTTTATAGTGG + Intergenic
1155800824 18:30101482-30101504 AAATAGAAACTCATCAATAGTGG + Intergenic
1156159161 18:34339082-34339104 AAAGAGAAACTGTATTATAGTGG - Intergenic
1156582734 18:38395998-38396020 AAATAGACACATATATATAGAGG - Intergenic
1156754903 18:40511956-40511978 AAATAGAAACAAAGTTATTTTGG - Intergenic
1156869523 18:41929325-41929347 AAATATAAGCAGATGTATAGGGG + Intergenic
1158144520 18:54296830-54296852 AATTAGAAACAGACTTACAAGGG - Exonic
1158321782 18:56271145-56271167 TAATACAAACACATTTAAAGTGG - Intergenic
1158368401 18:56767760-56767782 AAATGGAAACAGGCTTATACTGG + Intronic
1158547550 18:58409115-58409137 AATGAGAAACATATTTCTAGTGG - Intergenic
1158794919 18:60833582-60833604 AAATACATACAGATATATAGGGG - Intergenic
1158919084 18:62169167-62169189 AAATGCAAACAAATCTATAGTGG - Intronic
1158987291 18:62831131-62831153 AAATAGAACCAGATTACTTGGGG + Intronic
1159410461 18:68068301-68068323 AAATAAAAACTGATGTATTGTGG - Intergenic
1159631538 18:70754445-70754467 ATATAGAAACATTTTTGTAGTGG + Intergenic
1161179651 19:2871342-2871364 AAAAAGAACCAGATTCCTAGAGG + Intronic
1162757583 19:12869412-12869434 AAAAAGAAACAGGTTTAGAGAGG - Intronic
1163933121 19:20418111-20418133 AAATAGACACAGATTTGTTTAGG - Intergenic
1164451125 19:28365882-28365904 AAAGAGAAACTGATTTATTATGG + Intergenic
1167733524 19:51276784-51276806 AAATACAAATATATATATAGAGG - Intergenic
925398523 2:3554680-3554702 AAACAGAAACATACTTATATTGG + Intronic
925710829 2:6738489-6738511 GTATAGCAACAGGTTTATAGAGG + Intergenic
925957066 2:8977202-8977224 AAATTTAAACAGCTTTATTGAGG - Intronic
926226286 2:10969365-10969387 ACATAGATACATATTTAAAGTGG - Intergenic
926500535 2:13647836-13647858 AGACAAAAACAGATTTTTAGAGG + Intergenic
928160506 2:28919824-28919846 AAATAAAAATAAAGTTATAGGGG - Intronic
928239607 2:29575050-29575072 AAATAGAGTCTGATTTAGAGAGG - Intronic
928339812 2:30433156-30433178 ATATATAAACAGCTTTATTGAGG - Intergenic
928473170 2:31594583-31594605 AGATAGCAACAGAGTAATAGTGG + Intergenic
928536371 2:32245325-32245347 AAAAAAAAACAGATGAATAGAGG + Intronic
928691535 2:33804525-33804547 AAATAAAAACAGTTTTATAAAGG - Intergenic
929709675 2:44254042-44254064 AAAAACAAATAGATTCATAGTGG + Intergenic
930133239 2:47874263-47874285 AAATAGAAATATAATTACAGTGG - Intronic
930267941 2:49221820-49221842 GTATAGCAACAGCTTTATAGAGG - Intergenic
930413037 2:51051301-51051323 AAGTAGAAACATATTTATCCAGG + Intergenic
930428114 2:51237129-51237151 CAATAGAAACAGATTTCTTGTGG - Intergenic
930479957 2:51935480-51935502 AAAAAGAAATGGAGTTATAGAGG + Intergenic
930727093 2:54693017-54693039 AAAAAGAAAAAGATTTGGAGAGG - Intergenic
931165773 2:59746016-59746038 AAACAAAAACAGATTTCTGGGGG + Intergenic
931231843 2:60381730-60381752 AAATAGAAAAAGATAGACAGAGG + Intergenic
931842245 2:66165750-66165772 AAATAAAAAGAGATTTATTATGG + Intergenic
932289526 2:70564934-70564956 AAAGCGAAATAGATTTATTGTGG - Intergenic
932748964 2:74358802-74358824 AAATAGAAACAGATGCTTACTGG + Intronic
933057289 2:77686738-77686760 AAATATAAATAGCTTTATAAAGG - Intergenic
933368128 2:81380782-81380804 ACATAGAAAAAAATTTAAAGAGG + Intergenic
933392675 2:81691712-81691734 TAATAGAAACACATTTAGAGGGG + Intergenic
933927428 2:87107938-87107960 AAATATAAATAGCTTTATAAAGG - Intergenic
935046145 2:99484900-99484922 ATAAAGAAACAGATTTAGAGAGG - Intronic
935208366 2:100916851-100916873 AATTAGAAACAGAAAGATAGCGG + Intronic
935511711 2:103984148-103984170 ATATAGAAGGAGATTTATTGTGG - Intergenic
935895826 2:107736408-107736430 ATGTAGAAACAAATTTATTGTGG + Intergenic
935940881 2:108238155-108238177 AAAAAGAAAAAGATAAATAGTGG + Intergenic
936181921 2:110274522-110274544 AAATAGAAATAGAAATAAAGGGG - Intergenic
936230647 2:110697157-110697179 AAATAGAAATAGAAATAAAGGGG + Intergenic
936479722 2:112874978-112875000 AACTAGATTCACATTTATAGAGG - Intergenic
936660719 2:114540594-114540616 AAATAGAAAAATATTTAGTGTGG - Intronic
936956703 2:118029697-118029719 AAAAAAAATCAGAATTATAGGGG - Intergenic
937821014 2:126310983-126311005 AAAAATAAACAAATTAATAGAGG + Intergenic
938641392 2:133284355-133284377 AAATAAAAACAGATTTTAAATGG + Intronic
939176615 2:138756233-138756255 AAAATGAAAAAGATTTATATTGG - Intronic
939318933 2:140590374-140590396 CTATAGAAAATGATTTATAGTGG + Intronic
939467911 2:142581878-142581900 ATAGACAAACAGATTTATAGGGG - Intergenic
939531089 2:143362669-143362691 AGAGAGAAACAGATTTTGAGTGG - Intronic
939789540 2:146554816-146554838 AAATACAAACATACCTATAGGGG + Intergenic
939843259 2:147213922-147213944 AATTAGAAACAAATTTATTTAGG + Intergenic
940340855 2:152579395-152579417 AAATAGAAAAATAATTGTAGTGG + Intronic
940724969 2:157326637-157326659 AAAAAGAAAAAGATTTAAAAAGG - Intronic
940725925 2:157336228-157336250 AGATAGAAACAGATTTATACAGG - Intergenic
941304088 2:163839607-163839629 GAATAGAAACAGACTAATAAAGG - Intergenic
941695152 2:168543371-168543393 AGATAGAAGCAGATTGATGGGGG - Intronic
942114646 2:172716041-172716063 AAATTGCCACAGATTTATAAAGG + Intergenic
942202711 2:173587979-173588001 AAATAGAAGCAGAGTGAGAGAGG + Intergenic
942558169 2:177192686-177192708 AAATAGAAATAGGTTTTTAAAGG + Intergenic
942822471 2:180131844-180131866 AAATAGAAAACAATATATAGTGG + Intergenic
943503103 2:188716701-188716723 AAATACAACCAAATTTGTAGAGG - Intergenic
943607650 2:189995233-189995255 AGATAGCAACACATTAATAGTGG - Intronic
943869285 2:192973460-192973482 AAATGGAAACAGATTTGGACCGG + Intergenic
944106159 2:196081961-196081983 AAATAGAAGCTGGATTATAGAGG - Intergenic
944287954 2:197973539-197973561 AAATTGAGACAGACTCATAGAGG + Intronic
945217506 2:207449859-207449881 AAATAGAGACAGCTCTAAAGAGG + Intergenic
945851239 2:215010302-215010324 AAATAGAAACTGAGTTATAATGG + Intronic
945908050 2:215616060-215616082 AAATAGAAACTAATCTATATGGG + Intergenic
946039156 2:216769135-216769157 AAATATAAGCAGAGTTAGAGTGG + Intergenic
946111526 2:217422510-217422532 AAATAAAAAAAAATTTATAAGGG + Intronic
946565004 2:220954654-220954676 ATTTAGAAATAGATTTAGAGAGG - Intergenic
946778520 2:223169329-223169351 CAAAAGAAACCGATTTATTGCGG + Intronic
946915981 2:224522212-224522234 AAATAAATACAGATTTAAAAAGG + Intronic
947508940 2:230733123-230733145 AAATAGTCACAGATTAGTAGGGG + Intronic
948007832 2:234624923-234624945 GAATTGAAGCATATTTATAGTGG - Intergenic
948444578 2:238022315-238022337 AAATATAAACAGCTTATTAGTGG - Intronic
1169597490 20:7217308-7217330 AATCAGTAACAGATTTAAAGTGG - Intergenic
1170045633 20:12082479-12082501 AAAAAGAGACAGATTGCTAGTGG - Intergenic
1170877750 20:20266915-20266937 ACATAGAAAGAGTTTCATAGAGG + Intronic
1172121953 20:32603700-32603722 AAATAGAAAGAAATTGAGAGGGG - Intronic
1173048611 20:39537049-39537071 AAATGGAAACAGCTTTATTTGGG - Intergenic
1173112291 20:40203289-40203311 AAATAGAAACAGTTACAGAGAGG - Intergenic
1173114584 20:40228600-40228622 AACTGGAGACAGAGTTATAGTGG - Intergenic
1173304962 20:41839455-41839477 AAATAGACAAAGATTTATGATGG + Intergenic
1173896301 20:46553232-46553254 AAATAGAATCAGCTTTGTTGAGG + Intergenic
1174761339 20:53209976-53209998 AAATTGAAACGCATTTGTAGAGG - Intronic
1175622992 20:60466500-60466522 AAATAGGAACACATTTTAAGAGG - Intergenic
1175993321 20:62800729-62800751 AAATAGTAACAGATTCTGAGTGG + Exonic
1176902792 21:14463598-14463620 AAATAGAAAAATATTAATAATGG - Intergenic
1176950805 21:15044118-15044140 AAATAAAAACAGATGAGTAGTGG - Intronic
1176992326 21:15512160-15512182 AAATAGAAATAGAGATAGAGAGG - Intergenic
1177420885 21:20854879-20854901 AAAAAGCAACAGATTGAGAGTGG + Intergenic
1177454297 21:21316157-21316179 AAAAAGTAAAAGATTTATAGGGG + Intronic
1177540417 21:22485626-22485648 AAGAAGAAACACATTTATAATGG + Intergenic
1177793511 21:25747072-25747094 ATGTAGAAACAGATTTAAAGAGG + Intronic
1178200614 21:30399534-30399556 TAATAAAAACAGATTCACAGGGG + Intronic
1178736010 21:35151950-35151972 AAATAGAAACAGACCCAAAGGGG + Intronic
1179371639 21:40811243-40811265 AAATACAAACAGACTTTTCGAGG + Intronic
1180164163 21:46011907-46011929 AAATAGAAACAGTGTCTTAGTGG - Intergenic
1180576122 22:16776307-16776329 AAAGACAAACAGATTTGAAGAGG - Intergenic
1181704006 22:24636919-24636941 ACATAGAGAGAGATTTATTGAGG - Intergenic
1182793545 22:32973425-32973447 AAAAAGAAAAAGATTAATAAAGG + Intronic
1183755572 22:39759550-39759572 AAATAAAAACAGATTAAAGGTGG - Intronic
1184638001 22:45850737-45850759 AAATAGAAACAAACTTAGAGGGG + Intergenic
1185159943 22:49217940-49217962 ACATAAAAATAGATTTACAGAGG + Intergenic
949201361 3:1383665-1383687 AAAAAAAAACAGCTTTATTGAGG + Intronic
949309367 3:2679002-2679024 AATTCAAAACAGATATATAGGGG - Intronic
950175244 3:10868927-10868949 AAATTGAATCAGATTTTCAGAGG - Intronic
951073944 3:18366523-18366545 AAAAAGAGACATATTTAAAGAGG + Intronic
951256074 3:20451407-20451429 AGATAAAAACAGATTTTGAGAGG + Intergenic
954474741 3:50733362-50733384 AAATATTAACAGATCTAAAGGGG - Intronic
954602881 3:51884711-51884733 AGATAGAAACAGATTTATCATGG + Intergenic
954929070 3:54264588-54264610 AAATAGAAACGGAGACATAGAGG + Intronic
955901628 3:63762197-63762219 ATATAGAACTAGATTTAAAGCGG - Intergenic
956045544 3:65192090-65192112 AAAGAGAAACAGGTTCATAATGG - Intergenic
956146975 3:66200109-66200131 AAATATAAACAAATATATAGTGG + Intronic
956995451 3:74822242-74822264 AGATAGAAACACAATAATAGTGG - Intergenic
957027827 3:75204827-75204849 AAATAGAAGCAACTCTATAGAGG - Intergenic
957134257 3:76264600-76264622 AAATAGTTACAGATTCATAGTGG + Intronic
957527480 3:81395792-81395814 AAATAGAATCAGATTAATCCGGG + Intergenic
957768779 3:84660532-84660554 AAATAAAATCAAATTTAAAGAGG + Intergenic
957918103 3:86712407-86712429 AAATAAATACAAATTTATTGAGG + Intergenic
958729273 3:97943718-97943740 ATAAAGAAACAGATTTCTATAGG + Exonic
959077930 3:101770443-101770465 AAATAGTAAATGATTTAAAGTGG + Exonic
959463445 3:106654956-106654978 AAAAAGAAACAGTTTTTTGGAGG - Intergenic
960337121 3:116431523-116431545 AAACAGAAACAGTTTCATAATGG - Intronic
960411446 3:117331417-117331439 AAAAAAAAAAAGATTTTTAGTGG + Intergenic
960600065 3:119448108-119448130 AAAAAGAAACTTATTTATATAGG - Intronic
960652444 3:119966432-119966454 AAGAAGAAACAAATTTAGAGAGG + Intronic
960754164 3:120991355-120991377 AAATAGGAACACTTTTACAGTGG + Intronic
960806446 3:121588028-121588050 AAATAAAAACAGATTTTTGAAGG + Intergenic
960962075 3:123078445-123078467 AAATAATATCAGATTTATAGAGG + Intronic
961263046 3:125617801-125617823 AAATAGTACCATATTTATATTGG - Intergenic
962239818 3:133742984-133743006 AAAGAGAAAGAGATTGATAGAGG - Intergenic
962282733 3:134064520-134064542 AAAAAAAAACAGTTTTATTGAGG + Intergenic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
963866957 3:150371853-150371875 AAGTAAAAAGGGATTTATAGTGG - Intergenic
964370641 3:155996618-155996640 AAAAAGAAACAATTTAATAGTGG + Intergenic
965018620 3:163195521-163195543 AAATTGAAACAAAATTATAACGG + Intergenic
965357636 3:167696000-167696022 AAAAAAAAACAGATTTAAAAGGG + Intronic
965462682 3:168987363-168987385 AAATAGATTCAGATATATACAGG - Intergenic
966247033 3:177820341-177820363 AAATAGAAACAAATTAATGCTGG - Intergenic
966281288 3:178232789-178232811 TAATATAGACAGATTTATTGAGG - Intergenic
966433982 3:179862368-179862390 AAATATAAACAAATATAAAGGGG + Intronic
966690202 3:182733699-182733721 AAATAAACACAGGTTTATTGAGG - Intergenic
966727826 3:183123563-183123585 AAACAAAAACAAATTTAAAGTGG + Exonic
966877342 3:184330380-184330402 AAATAAAAAAAGATATATATCGG + Intronic
967236727 3:187392282-187392304 AGAAAAAGACAGATTTATAGTGG + Intergenic
967579879 3:191139683-191139705 ACATATAAACAGATTTTTAATGG + Intergenic
967611364 3:191509803-191509825 AGAAAGAAACTGATATATAGAGG + Intergenic
969933886 4:10661951-10661973 AAATAGAGATAGATATTTAGAGG - Intronic
970380988 4:15507720-15507742 AAGTAGAAAATGATTTTTAGGGG + Intronic
970589384 4:17546194-17546216 AAATAGAAGCAGAGGTATCGAGG + Intergenic
970599689 4:17631837-17631859 ACATAGAAACAGCTTTCCAGTGG + Exonic
970809212 4:20071937-20071959 AAATAAAAAGAGGTTTATTGGGG + Intergenic
970945010 4:21681060-21681082 ATAAAGAAAAAGATTTATATTGG - Intronic
971190631 4:24425446-24425468 AAATAGACAAAGATATATGGTGG + Intergenic
971579846 4:28322263-28322285 ATATAGAAACAGATGGATATTGG + Intergenic
972209218 4:36816557-36816579 ATATAGAAATATATTTATAAAGG + Intergenic
973139320 4:46746607-46746629 ATATAGAAACAAAATCATAGAGG - Intronic
973169318 4:47119870-47119892 AAATAGTAACAGATTTTAAAAGG + Intronic
974278359 4:59757501-59757523 AAATAGAAACATTTTTATGTGGG + Intergenic
974343063 4:60639004-60639026 AAATAGAAACAAAGTTATCCAGG - Intergenic
974409082 4:61515620-61515642 AAATATAAGCACATTTAGAGTGG - Intronic
974424789 4:61727341-61727363 ATATATAAACATATTTATAGAGG + Intronic
974593898 4:63992512-63992534 AAATAGAAACAGAAATATGAAGG - Intergenic
975477085 4:74835665-74835687 CAATTGAAACAGATTCACAGAGG + Intergenic
975788403 4:77920025-77920047 AAATAAAAACAGATTTGCATAGG + Intronic
975818263 4:78242203-78242225 ATAAAGAAACTGATTTTTAGTGG + Intronic
976261767 4:83152233-83152255 AAATAGATAGACATATATAGAGG + Intergenic
976634196 4:87271227-87271249 AAATTGAAATAGAATTATACTGG - Intergenic
976684742 4:87800263-87800285 AAATAAAATTAGATTTATATAGG + Intronic
976777519 4:88722322-88722344 AAAAAGAAACAGATTTCTGGAGG + Intergenic
976828968 4:89291625-89291647 ACATAAAAACTTATTTATAGTGG - Intronic
976898707 4:90144875-90144897 ACATAATAACAGATTAATAGTGG - Intronic
976927821 4:90523335-90523357 AAATAGAAACAAATTTAAATTGG - Intronic
977173485 4:93791572-93791594 AAAAACAAACACATTTTTAGTGG - Intergenic
978085393 4:104645738-104645760 ATATAGAGAAAAATTTATAGGGG - Intergenic
978197948 4:105992108-105992130 AAAAAGAAACAGAGTCAGAGAGG - Intronic
978393228 4:108249970-108249992 AAATATAAACAAATCTATAGTGG + Intergenic
978453738 4:108865264-108865286 AAATAGAATTAGATCTATGGTGG + Intronic
978552688 4:109944786-109944808 AAATAGGAACAGAGTAAGAGTGG - Intronic
978704235 4:111686413-111686435 AAATAGAAAAAAATTCATAGTGG - Intergenic
978856867 4:113403563-113403585 AAATGGAAACTGATGAATAGAGG + Intergenic
979253742 4:118591186-118591208 AGATAGAAATAGATATATACAGG - Intergenic
979303931 4:119120502-119120524 AAATAGGAACAGATATATTTTGG + Intergenic
979600379 4:122580991-122581013 AAAGAGAAAGAGATTGAGAGAGG + Intergenic
979730322 4:124016052-124016074 AAATAGAAAAAGGTTTATCCTGG + Intergenic
979782249 4:124667599-124667621 ATATAGATAAAGATATATAGAGG - Intronic
979873072 4:125850782-125850804 TAAAAGAAAGAGAATTATAGGGG - Intergenic
980337250 4:131492317-131492339 ATATAGAAACAGTTATATATAGG - Intergenic
980653859 4:135757185-135757207 AAATACAAAAAAATATATAGTGG - Intergenic
980953456 4:139404783-139404805 TAAAAAAAACAGCTTTATAGGGG + Intronic
981129283 4:141140480-141140502 AAAAGGAAACAGATGTATTGTGG - Intronic
981463879 4:145043624-145043646 TAATAAAAAAAGATTTATAATGG - Intronic
981642522 4:146961311-146961333 AAGTAGAAACCGATTTACAATGG - Intergenic
981714049 4:147735167-147735189 AATTAGATACGGATTTATAATGG + Intronic
982281676 4:153689601-153689623 TTATAGAAACAGATTTATTATGG + Intergenic
982403623 4:154996571-154996593 AAATAGAAACAGATCCACTGGGG + Intergenic
982516011 4:156350677-156350699 AAATAAAAACAGGTTTAAAAGGG + Intergenic
983446094 4:167854889-167854911 ATAAAGAAACAGGTTTACAGAGG + Intergenic
983545834 4:168963459-168963481 AAAAAAAAAAAGATTTATACAGG - Intronic
984324327 4:178232143-178232165 AAATAGAAACAGATAAATAATGG + Intergenic
984398979 4:179237598-179237620 ATATAGTAACAGATATATATGGG - Intergenic
984654356 4:182301319-182301341 AAATAAAAACAGTTTCATACAGG - Intronic
984995537 4:185426627-185426649 AACTAGAAACAGATTTAAGAAGG - Intronic
985354041 4:189098054-189098076 ATATAGAAAAATATTAATAGAGG + Intergenic
985669356 5:1199186-1199208 AAAGAGAAACAGAGAGATAGAGG - Intergenic
985800038 5:1999650-1999672 AAATAGAAGCACATTTCTTGTGG + Intergenic
986113090 5:4739562-4739584 GAATAGAAACACATTTGTACTGG - Intergenic
986697510 5:10371395-10371417 CAAAAGAAAGAGATTTATAATGG + Intronic
986835627 5:11633967-11633989 AAATAGAAACAGATGTCATGAGG - Intronic
987185766 5:15417420-15417442 AAATAGAAAAAGAATTTTGGAGG - Intergenic
987239360 5:15978320-15978342 ACATGGAAACATATTTATAGAGG - Intergenic
987543566 5:19285076-19285098 ATAAAGAAACAAATTTAAAGTGG + Intergenic
987715474 5:21563813-21563835 TAATAGAAACACAATAATAGTGG - Intergenic
987987832 5:25172136-25172158 AAATAGAAATAGATTCACAGAGG - Intergenic
988025328 5:25679305-25679327 AAATAGAAATAGATGTTTGGGGG + Intergenic
988053042 5:26055048-26055070 AAATGGAAACATGTTTATATGGG - Intergenic
988263222 5:28917572-28917594 AAATAGTACTAAATTTATAGAGG - Intergenic
989310075 5:40005501-40005523 AAATAGAATCAGAATGAAAGAGG - Intergenic
989393947 5:40932752-40932774 AAATAGAAGCAGAGAGATAGAGG + Intronic
990172143 5:53064153-53064175 AAATAGTGACATAATTATAGTGG - Intronic
990211591 5:53485440-53485462 AACTGGAAATAGATTTCTAGAGG - Intronic
990396162 5:55381223-55381245 AAATAGAGACAGAAAAATAGAGG - Intronic
990732959 5:58829423-58829445 ACAAAGAAAGAAATTTATAGAGG + Intronic
991051916 5:62281979-62282001 AAATAGAATCATAATTATACTGG + Intergenic
991943447 5:71877195-71877217 AGATAAAAATATATTTATAGAGG - Intergenic
992975855 5:82119131-82119153 AAATGGAAACATATTAATAAAGG - Intronic
993139465 5:84012281-84012303 AACCAAAAACAGATTTAGAGAGG - Intronic
993396948 5:87401457-87401479 AAATAGAGTCAGATTTAGAAAGG - Intronic
993659652 5:90617231-90617253 ACATAGAAAAAGAATTATATAGG - Intronic
993862887 5:93157882-93157904 GAACAGAAACACATTTATTGAGG + Intergenic
994416900 5:99483815-99483837 CAATAGAAACAGATTTTGACAGG - Intergenic
994653747 5:102562785-102562807 CAGCAGAAACAGATTAATAGAGG + Intergenic
994871508 5:105355731-105355753 AAATAGAAAATGATTTCTTGGGG + Intergenic
995847029 5:116504363-116504385 AAAGAGAAATTAATTTATAGAGG - Intronic
996030158 5:118695817-118695839 AAATTTACACAGATTTATTGAGG - Intergenic
996197287 5:120624624-120624646 AAATAGATACTAATTCATAGGGG + Intronic
996363761 5:122678202-122678224 AAATAAAAACAGATTTTTGAAGG + Intergenic
996940399 5:128998523-128998545 AAATATTAACAATTTTATAGTGG + Intronic
997037495 5:130210419-130210441 AAATAGAAATACAGTTATACGGG - Intergenic
997039469 5:130234610-130234632 AATTGGAAACATATTTCTAGGGG - Intergenic
997106595 5:131027286-131027308 ATATAAAAACAGATCTTTAGAGG + Intergenic
997133964 5:131305069-131305091 AAATAGAAACTAATCTCTAGTGG - Intronic
997933962 5:138094762-138094784 AAAGAGATAAAGATTTGTAGGGG - Intergenic
998428564 5:142050560-142050582 AAATAAAAACAGTTTTGAAGAGG - Intergenic
999397175 5:151237369-151237391 AAACAAAAACAGCTTTATTGAGG - Intronic
999599668 5:153248165-153248187 AAATAGCAACACAATAATAGTGG - Intergenic
999956463 5:156708587-156708609 ACATACAAACAGATGTATTGAGG + Intronic
999989709 5:157038496-157038518 ACATAGAAATAGATTCAGAGAGG - Intronic
1000922404 5:167153894-167153916 AGATAGAAACAGATTTCAAATGG - Intergenic
1000930879 5:167249811-167249833 ATAGAGAAACACATTTAGAGAGG - Intergenic
1001925973 5:175637473-175637495 AAATGCAAATAGATTTATTGAGG + Intergenic
1001991338 5:176118067-176118089 AAATAGTATCACATTTATTGAGG + Intronic
1002225536 5:177720068-177720090 AAATAGTATCACATTTATTGAGG - Intronic
1002268313 5:178051137-178051159 AAATAGTATCACATTTATTGAGG + Intronic
1002628929 5:180555440-180555462 AAATAAACACAGATGTCTAGAGG - Intronic
1002814084 6:662184-662206 AAACAGAAACACAATAATAGTGG + Intronic
1003289024 6:4762464-4762486 CAATAGAAACAGACCTACAGAGG + Intronic
1003325797 6:5089542-5089564 CAAGAGAAATAGATTTTTAGTGG + Intergenic
1003370057 6:5515847-5515869 AAATAGAAAAATATTTTAAGTGG + Intronic
1003529449 6:6925646-6925668 AAATAGAGACAGATGCATGGAGG - Intergenic
1004052811 6:12104940-12104962 CATTATAAACAGATTTACAGGGG - Intronic
1004911664 6:20291556-20291578 AAATAGAAAAAAATTTAAATAGG - Intergenic
1004921460 6:20379938-20379960 AAATAGAAACGGATTTCTGTAGG - Intergenic
1004990039 6:21126613-21126635 AAATAGAAACTGATTCATGAGGG - Intronic
1005105413 6:22219502-22219524 CAATTGAAACAAATTAATAGGGG + Intergenic
1005141804 6:22640790-22640812 CAATAGAAACATATTCATAGAGG + Intergenic
1005723697 6:28628118-28628140 ACAAAAAAACAGATTTATTGAGG - Intergenic
1006552568 6:34836856-34836878 AAATACAAACACATATATAATGG - Intronic
1007576545 6:42928885-42928907 AAATAGAAACAGGCTCAGAGAGG + Intergenic
1007670920 6:43552961-43552983 AAGAGGAAACAGATTTAGAGAGG - Intronic
1007965142 6:45997661-45997683 AAATACAAACATATGAATAGTGG + Intronic
1008185578 6:48386457-48386479 AGATAGAAACACAATAATAGTGG - Intergenic
1008474206 6:51918778-51918800 AAATAGAAACACTTTTACACTGG - Intronic
1008586020 6:52950322-52950344 AAATAAAAATGTATTTATAGGGG + Intergenic
1008733866 6:54517981-54518003 AAATATAAACAGATTAAAAGTGG - Intergenic
1009001249 6:57718231-57718253 TAATAGAAACACAATAATAGTGG + Intergenic
1009389163 6:63124863-63124885 AAAAAGGAACAGATAAATAGAGG - Intergenic
1009772063 6:68156457-68156479 AAATAGAAACATGTTTGTATTGG - Intergenic
1010238473 6:73595033-73595055 AAATAAAAATACATTAATAGAGG + Exonic
1010245618 6:73659358-73659380 TAATAGAAACATTTTCATAGGGG + Intergenic
1010588932 6:77689966-77689988 AAATATAAACATACTTATGGAGG - Intergenic
1010733353 6:79413776-79413798 AAATAAGAACAGATTCAGAGTGG - Intergenic
1010819120 6:80392507-80392529 AAATAGAAACAATATTATTGAGG - Intergenic
1010948045 6:82001532-82001554 AAATTTAAACTGATTTAAAGTGG - Intergenic
1010988730 6:82455292-82455314 AAATAAAAACAGCATTATATTGG - Intergenic
1011420826 6:87170669-87170691 AAATAAAACAAGATTTATAAAGG - Intronic
1011625081 6:89276239-89276261 GAATATAAACAGATCCATAGGGG + Intronic
1011670179 6:89675640-89675662 TAGTAGAAACAGCTTTCTAGAGG - Intronic
1012039061 6:94181551-94181573 AAACAGTAAAGGATTTATAGAGG + Intergenic
1012071294 6:94620612-94620634 AAAAACAAACAAATATATAGAGG + Intergenic
1012433966 6:99194967-99194989 AAATAGAATAAAATTGATAGAGG - Intergenic
1012510066 6:99992452-99992474 AACTAGAAATAGATTTTGAGGGG - Intronic
1012527495 6:100196078-100196100 AATTACAAAAACATTTATAGTGG - Intergenic
1012762964 6:103325988-103326010 TAATAGCATAAGATTTATAGTGG + Intergenic
1013177275 6:107688601-107688623 AATAAGAAACAGATTTTTTGGGG + Intergenic
1013255623 6:108381842-108381864 AAATAGAAATACATTTTTATGGG + Intronic
1014303620 6:119713651-119713673 AATTAGGAACAGCTTTAAAGTGG + Intergenic
1014511182 6:122324614-122324636 AAATATAAACAAATGTAAAGAGG - Intergenic
1014774465 6:125492885-125492907 AAATAGCAAAGGAATTATAGTGG + Intergenic
1015647950 6:135415948-135415970 AAATGCAAACTAATTTATAGTGG + Intronic
1017663359 6:156695469-156695491 AAACATAAACAGATCTGTAGCGG + Intergenic
1018310077 6:162499396-162499418 ATAAAGAAACAGATTTGAAGAGG - Intronic
1018529875 6:164751321-164751343 AAGTAGAAAATGATTTTTAGGGG + Intergenic
1020282783 7:6658725-6658747 AAAATGAAATAGATTTAAAGAGG - Intergenic
1020479917 7:8646771-8646793 AAATAAAAATAAAATTATAGAGG - Intronic
1020830935 7:13094783-13094805 TTATAGAAACAGAATAATAGTGG + Intergenic
1020926904 7:14339800-14339822 AAATTGAAATATATTTACAGTGG + Intronic
1021822216 7:24509342-24509364 AAAAAAAAACAGCTTTATTGAGG - Intergenic
1022182751 7:27938389-27938411 ACAGAGAAACAGATTTTCAGAGG - Intronic
1022237012 7:28471883-28471905 AAACATTAACAGATTAATAGTGG - Intronic
1022365871 7:29715622-29715644 AAATAAAAACAGATTCAGAAAGG - Intergenic
1022587312 7:31626458-31626480 AAATGCAAACAGAAATATAGTGG - Intronic
1022695025 7:32696625-32696647 AAATACAAACAGATTCAGAAAGG + Intergenic
1022962651 7:35444437-35444459 AAAAAGAAAAATATTAATAGTGG - Intergenic
1023107443 7:36776059-36776081 AAAGATAAACACATTTTTAGGGG + Intergenic
1023236120 7:38089891-38089913 AAGTAGAAAAAAATTTATAACGG + Intergenic
1023473581 7:40552301-40552323 AATTAGAAACAGAGGTATGGAGG - Intronic
1023645082 7:42303369-42303391 AAATGGACACAGATTTGAAGAGG - Intergenic
1023701488 7:42895633-42895655 AGATAGAAACAAAATAATAGTGG + Intergenic
1024398058 7:48891378-48891400 ATACAAAAACAGATTTTTAGAGG - Intergenic
1024478683 7:49841389-49841411 AAAAAGAAACAATTTCATAGTGG + Intronic
1024705313 7:51951768-51951790 AAAAAAAAACAGCTATATAGTGG - Intergenic
1025039516 7:55628958-55628980 AAATAACAGCAGATTTAGAGTGG + Intergenic
1025246147 7:57319063-57319085 ATAAGGAAACAGATTTAGAGTGG - Intergenic
1027508513 7:79049560-79049582 AAATAGATACAGATGTATGTTGG - Intronic
1027681381 7:81225847-81225869 CAAAAGCAACAGATTTACAGTGG - Intergenic
1027955125 7:84868332-84868354 AAATAGAAACAGCTATTTATAGG + Intergenic
1028254257 7:88573594-88573616 TAATAGCAACAAATTTATATAGG - Intergenic
1028622381 7:92838007-92838029 ACATAGAATCAGTTTTATAAAGG - Intergenic
1028901411 7:96104139-96104161 AAATAGAAATAATTTTAAAGTGG - Intronic
1029799402 7:102930365-102930387 AAATGGAAACAGGTTTATAGAGG - Intronic
1029872333 7:103708100-103708122 AAATAGAACCAGAGTAAAAGTGG - Intronic
1030423626 7:109342444-109342466 AAATAGAAGCAAAATAATAGAGG - Intergenic
1030573710 7:111259795-111259817 AAATAGAAAATGACTTATAAAGG - Intronic
1030972530 7:116077807-116077829 AAACAGAAACACTATTATAGTGG + Intronic
1031169240 7:118271586-118271608 AGATAGCAACAGAGTAATAGTGG - Intergenic
1031196616 7:118623094-118623116 AATTAATAACAGATTTTTAGAGG + Intergenic
1031299712 7:120049637-120049659 AAATAGTCAAAGATTTATTGGGG + Intergenic
1031679742 7:124656893-124656915 AAATTGAGACAGATTTTCAGGGG + Intergenic
1031800996 7:126245336-126245358 AAATAGATATACAATTATAGTGG + Intergenic
1032105211 7:129022648-129022670 AAAGAGCAACTGATTTATAAAGG + Intronic
1033475886 7:141691909-141691931 AAAAAAAAACAGATTTATTAAGG + Intronic
1033532924 7:142284054-142284076 AAATTAAATAAGATTTATAGGGG + Intergenic
1033858251 7:145592367-145592389 AAATAAAAGTAGATTTATTGGGG - Intergenic
1033976837 7:147113229-147113251 AAATACAAACATATTTCTATAGG + Intronic
1034291835 7:149938795-149938817 AAATTGAAACATAATTATATGGG + Intergenic
1034814247 7:154158100-154158122 AAATTGAAACATAATTATATGGG - Intronic
1038172574 8:25150544-25150566 AAATATAAACTTATTTATAATGG + Intergenic
1038300688 8:26344266-26344288 AAATAAAATGAGATTTAGAGAGG + Intronic
1038368650 8:26964510-26964532 ATATGGAGACAGATATATAGAGG - Intergenic
1038596170 8:28888718-28888740 TTATATAAACAGATTTATACGGG + Intronic
1038790194 8:30661689-30661711 AAATAGAGACAGAGTTAGAGAGG + Intergenic
1038951124 8:32415717-32415739 AAATACAAAGAGAGTTAAAGGGG - Intronic
1039015162 8:33139665-33139687 AAGCAGAACCAGATGTATAGTGG - Intergenic
1039092934 8:33851883-33851905 GAATAGAAACAGGTTGATGGAGG + Intergenic
1039331360 8:36540938-36540960 AAACACCAACAGATTTTTAGAGG + Intergenic
1039333947 8:36569404-36569426 AAGGAGAAACAGTTTTATTGTGG - Intergenic
1039751639 8:40484094-40484116 AAAAAGAAACAGATATGAAGAGG + Intergenic
1040365463 8:46710614-46710636 AAATAAAAGCATATTTAAAGGGG - Intergenic
1040592831 8:48810845-48810867 AAATAGAAGAATATTTAAAGAGG - Intergenic
1041149950 8:54921424-54921446 AAAAAGAAAGAGATTCAGAGAGG + Intergenic
1041210699 8:55548311-55548333 AAAGAGAAACGGAATGATAGTGG - Intergenic
1041528725 8:58838321-58838343 AAATCAAAATAGAATTATAGGGG + Intronic
1041629441 8:60069347-60069369 AAATAAAAACAGTTTTTTAACGG + Intergenic
1041733053 8:61082256-61082278 AAAGAGAAAAAGATTTAAAAAGG + Intronic
1042097716 8:65235896-65235918 AAATAGAAACAGCTATCTACAGG + Intergenic
1042493044 8:69423703-69423725 TAACAGAAACAAATTTAGAGGGG - Intergenic
1042643614 8:70961233-70961255 AAGTAGAAGCAGAGGTATAGAGG + Intergenic
1042791524 8:72612569-72612591 AATTAGAACCAGATTTTCAGGGG - Intronic
1043057695 8:75461027-75461049 ATAAAGAAAGAGGTTTATAGAGG + Intronic
1043071445 8:75641203-75641225 AAATAGCAACACAATAATAGTGG - Intergenic
1043169844 8:76952113-76952135 CAATAGAAACATATTTGGAGGGG - Intergenic
1043343732 8:79273866-79273888 AAAGAGAAACAAATTAAAAGTGG + Intergenic
1043642003 8:82465518-82465540 ACAGATAAACAGATTTATAGTGG - Intergenic
1043766943 8:84147509-84147531 ATTCAGAAACAGATTTAAAGAGG + Intergenic
1043854447 8:85248470-85248492 AAAAAGAAAAAGAATTATGGTGG + Intronic
1043882279 8:85558061-85558083 TAATAGAAACAAAATTATATTGG - Intergenic
1043964582 8:86459521-86459543 AACTGGAAACAGTTCTATAGAGG + Intronic
1044796582 8:95906188-95906210 AAATAAATACAAATCTATAGAGG + Intergenic
1045691175 8:104761620-104761642 AATTAGATTCAGATTTTTAGTGG - Intronic
1045837035 8:106534829-106534851 AAATGGAAAGAGGTTAATAGGGG + Intronic
1045938246 8:107708052-107708074 ACATTAAAAGAGATTTATAGTGG - Intergenic
1046034922 8:108829272-108829294 AGACAGAAAGACATTTATAGAGG - Intergenic
1046050690 8:109018710-109018732 ATATAAAATCTGATTTATAGTGG - Intergenic
1046303029 8:112323176-112323198 AAAGAGAAACAGATGAAAAGAGG - Intronic
1046599828 8:116303118-116303140 AAATATAAACACAGTTGTAGGGG + Intergenic
1046614900 8:116465367-116465389 AAAAAGAGATAGATTTCTAGTGG - Intergenic
1047220246 8:122912859-122912881 AAAGAAAAACAGCTTTATTGGGG + Intronic
1048824233 8:138408231-138408253 AGATATAAACAGCCTTATAGAGG - Intronic
1050071104 9:1815174-1815196 AAAGAGAAAGAGAATTAAAGAGG + Intergenic
1050320549 9:4447901-4447923 AAATAGAAATAAATTTAAAAAGG - Intergenic
1050382942 9:5050202-5050224 AAATGGAAACTGATTTACACTGG - Intronic
1050487931 9:6154621-6154643 AGATATAAACAGATTAAAAGTGG + Intergenic
1050547746 9:6723033-6723055 AAACAGCAAGAGATTTACAGTGG + Intronic
1050909892 9:11055508-11055530 AAAGAGAAACACATTTTTTGAGG + Intergenic
1052011059 9:23409772-23409794 AAATATAAACAGATACATATTGG + Intergenic
1052086877 9:24278527-24278549 AAATAGAAAAATATTTTGAGTGG + Intergenic
1052174881 9:25447043-25447065 AAATAGAAACAGAATAAAATTGG - Intergenic
1052298116 9:26921481-26921503 AAATTGAAACAGATTAAGATGGG - Intronic
1052452429 9:28649382-28649404 ATATAGATACTAATTTATAGAGG + Intronic
1052520180 9:29537091-29537113 AAATAAAAAAAAATTTAGAGAGG - Intergenic
1052556353 9:30023167-30023189 AAATATAAACTGGTATATAGAGG + Intergenic
1052587403 9:30447093-30447115 AAGTAGAGACAGATTTAGATAGG - Intergenic
1052802396 9:32981394-32981416 AGATAAACACAGAATTATAGGGG + Intronic
1053189691 9:36052472-36052494 AAATAAAAATAAAATTATAGAGG + Intronic
1055223766 9:73969613-73969635 AAAATGAAACATATTTATAAGGG + Intergenic
1055493493 9:76829959-76829981 GAATAGAAACAGAATCAGAGGGG + Intronic
1056125176 9:83529357-83529379 TAATAGATACAGATTTATTCTGG + Intronic
1056489552 9:87091909-87091931 AGATAGAAAGAGATTTATTAGGG + Intergenic
1056526736 9:87450221-87450243 AAATAAAAGCAGATGTATTGTGG - Intergenic
1056733878 9:89188185-89188207 AAATACAAAAAAATTTTTAGTGG + Intergenic
1057159046 9:92872404-92872426 AAATAGAAACAGATTCTTTCAGG + Intronic
1057338308 9:94175420-94175442 AAATAGAAACTAATTTTTAAAGG - Intergenic
1058231841 9:102435944-102435966 AAATAGAAACAGACACATATTGG + Intergenic
1058863196 9:109137662-109137684 AAAAAAGAACAGATTTATAATGG + Intronic
1059119602 9:111630457-111630479 TGATAGAAACAGATTTTTTGAGG + Intergenic
1059378336 9:113903456-113903478 AAACAGAGGCAGATTTATTGGGG - Intronic
1060354249 9:122889839-122889861 TAATAAAAACGGATTTATATTGG + Intronic
1060761475 9:126254264-126254286 AAATAGAAACACATTAGTAGTGG + Intergenic
1061732570 9:132627592-132627614 CATTAGAAACACATTTAAAGGGG + Intronic
1185801080 X:3011761-3011783 AAAGAGAAACAGTTTTATTAAGG - Intronic
1185921619 X:4099267-4099289 AGATAGATACAGATTTATTATGG - Intergenic
1185935648 X:4254435-4254457 GAATAGAAAAAGATTTATAGTGG - Intergenic
1186066575 X:5772604-5772626 AAACAGAAACAGAGGTATAAAGG + Intergenic
1186157563 X:6741512-6741534 AGATAGATATAGATATATAGAGG + Intergenic
1187094629 X:16134408-16134430 AAATAGAAACAGATTTATAGAGG - Intronic
1187558626 X:20377791-20377813 AAATAGAAACAGGTTTATTGAGG + Intergenic
1187782118 X:22838727-22838749 ATAAGGAAACAGTTTTATAGGGG + Intergenic
1187920587 X:24197614-24197636 AACTAGAAAAATATTTATAATGG + Intronic
1188010204 X:25046761-25046783 AAATACAAACAGTTTAAAAGGGG - Intergenic
1188753416 X:33931346-33931368 AAATAGAAAAGCATTTATAGAGG + Intergenic
1189136364 X:38554800-38554822 ATATAGAAACAGATGAACAGGGG + Intronic
1189629604 X:42938963-42938985 AAATAGAAACACATTTAAAGAGG - Intergenic
1189650203 X:43180679-43180701 AGACAGCAACAGATTAATAGTGG - Intergenic
1190256419 X:48766078-48766100 AAATATAAAGAGATCAATAGAGG + Intronic
1190320183 X:49175535-49175557 AAATAGAAACAAACTGATAAAGG + Exonic
1190367436 X:49709487-49709509 GAAAGGAAACAGTTTTATAGTGG + Intergenic
1190852006 X:54253886-54253908 AAATGGAGACAGAATTATAGGGG + Intronic
1190882314 X:54500522-54500544 AAAGAGGAACAGATTTTCAGGGG + Intergenic
1190883344 X:54509278-54509300 AAATAAATAAAGATATATAGAGG - Intergenic
1191662113 X:63662414-63662436 AAATAGAAACTGAGTTTTATAGG + Intronic
1191798594 X:65052147-65052169 AATTAGAAAAAGAATTATGGTGG - Intergenic
1191913747 X:66179690-66179712 AGATAGAAACACAATAATAGTGG - Intronic
1192035755 X:67561123-67561145 AAAGAGAGACAGATGTTTAGAGG - Intronic
1192303476 X:69932126-69932148 AAATGAAAACTGATCTATAGTGG + Intronic
1192329187 X:70160356-70160378 AAATAGTAAGTGATTTATAAAGG + Intronic
1192348252 X:70331007-70331029 ACATAGGAACAGCTGTATAGTGG + Intronic
1192564105 X:72148606-72148628 ACTTTGAAACAGATTTATAGAGG + Intergenic
1192569783 X:72193567-72193589 AAATAGAAAAAAGCTTATAGTGG + Intronic
1193251333 X:79294225-79294247 AAATAGCAACACATTAATAGTGG + Intergenic
1193329678 X:80222456-80222478 AAAAAAAAACACATTTCTAGGGG + Intergenic
1193532016 X:82666672-82666694 AAAGAGAAACAATTTTATATGGG - Intergenic
1193880308 X:86912811-86912833 CAATAGCAACATATTTATAATGG + Intergenic
1194063510 X:89234362-89234384 AAATAGTAACAGATTGTTGGAGG - Intergenic
1194418970 X:93649314-93649336 AAATTGAAACATATTTAAAAAGG + Intergenic
1194790500 X:98142576-98142598 AAATAGAATCAAATAGATAGAGG + Intergenic
1194999242 X:100625970-100625992 AAAAAGAAAAATATTTTTAGTGG + Intergenic
1195250905 X:103045888-103045910 GAATAGAAACAGACACATAGTGG - Intergenic
1195841076 X:109177849-109177871 TAATAGAAATAGAATTATAAGGG - Intergenic
1197081034 X:122417131-122417153 AAAGAGAAACAAATTCAAAGAGG - Intergenic
1197130217 X:122996815-122996837 AAATAGAAACATATATGAAGGGG - Intergenic
1197377126 X:125694688-125694710 GAATAGCAACAAATTTATTGAGG - Intergenic
1197568394 X:128117359-128117381 GAATAGAAACAGACTAATACAGG - Intergenic
1197615658 X:128687745-128687767 AAATTGAAAGAGATTTATAGGGG + Intergenic
1197639574 X:128952983-128953005 AAATAGACCCAAATATATAGAGG - Intergenic
1197680197 X:129374669-129374691 AAAAAGAAACAGATTCAGCGAGG - Intergenic
1198513225 X:137375171-137375193 AAATGGAAGCAGATCGATAGTGG - Intergenic
1199085069 X:143618518-143618540 AAACAGAAACAGTTTTAGTGAGG + Intergenic
1199106458 X:143874883-143874905 CAAAAGAAAGAGGTTTATAGTGG - Intergenic
1199328564 X:146531240-146531262 AAATAGAAAAAAATTTGCAGGGG - Intergenic
1199496465 X:148457949-148457971 TAACAGAAAAAGATTTATAGAGG + Intergenic
1200717685 Y:6568468-6568490 AAATAGTAACAGATTGTTGGAGG - Intergenic
1200758068 Y:7010285-7010307 AAATTGAAACACAATTATTGGGG - Intronic
1201243883 Y:11984770-11984792 AATTACAAACAGTTTAATAGAGG - Intergenic
1201528495 Y:14963447-14963469 AAATAGAAATAGAGGTATAAAGG - Intergenic
1201688322 Y:16732610-16732632 AAATAGGAACACTTTTATACAGG - Intergenic
1201720076 Y:17086924-17086946 AAATAGAAAATGATTTATCATGG - Intergenic