ID: 1187095045

View in Genome Browser
Species Human (GRCh38)
Location X:16139303-16139325
Sequence GTGGACTCGCTTTCCTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187095043_1187095045 8 Left 1187095043 X:16139272-16139294 CCAAGAGGTTGTCGTAGAAGTTG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1187095045 X:16139303-16139325 GTGGACTCGCTTTCCTTTTCAGG 0: 1
1: 0
2: 0
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187095045 Original CRISPR GTGGACTCGCTTTCCTTTTC AGG Intronic
902839177 1:19064686-19064708 GTGGCCTCAGTTTCCTTGTCTGG + Intergenic
907513108 1:54977122-54977144 GGCAACTCACTTTCCTTTTCTGG + Intergenic
908514414 1:64877580-64877602 GTTAACTCTCTTCCCTTTTCTGG + Intronic
909506296 1:76394031-76394053 GTGGGGTGGCTTTCCTTTTGTGG + Intronic
918062995 1:181078232-181078254 GAGGACTCCTTGTCCTTTTCAGG + Intergenic
923474719 1:234321704-234321726 GTGGCCTGGGATTCCTTTTCTGG - Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
1064298917 10:14104496-14104518 GTGGCCTCACCTTCCCTTTCTGG - Intronic
1064573781 10:16723807-16723829 GTGGACTGAGTTTCCTTTTGGGG - Intronic
1066687510 10:37994666-37994688 GTGATCTCACTTTGCTTTTCTGG + Intergenic
1066697421 10:38091424-38091446 GTGGACTCACTTTCCTGGGCAGG - Intergenic
1066778967 10:38921879-38921901 GTGGACTACCTTGCCTTTCCTGG - Intergenic
1071576945 10:86734376-86734398 GTGTAGTCGCTTCCCTTTTTAGG + Exonic
1071708387 10:88024542-88024564 GTGGCCACCCTTTCCTTTTCTGG - Intergenic
1079407856 11:20161219-20161241 GGAGACTCGTTTTACTTTTCAGG - Intergenic
1088171455 11:107002136-107002158 CTTGGCTCTCTTTCCTTTTCTGG - Intronic
1089354006 11:117837947-117837969 GTGGACTCGCTTTCCCAGGCAGG - Exonic
1090602997 11:128391897-128391919 CTGGACTCTCTCTCCTCTTCAGG - Intergenic
1091581183 12:1790965-1790987 GTGGACTTCATTTACTTTTCTGG + Intergenic
1091937332 12:4444236-4444258 GTGGCCCCCCTTTCCTTGTCAGG - Exonic
1092166437 12:6345632-6345654 GTTGACTCATTTTCCTTATCAGG - Intergenic
1093066554 12:14664303-14664325 TTGTACTCACTTTCGTTTTCTGG - Intronic
1096512493 12:52139011-52139033 GTGGATACCCTCTCCTTTTCCGG + Intergenic
1097131936 12:56817804-56817826 GAGGACGCACTTTACTTTTCTGG + Intergenic
1098190272 12:67940728-67940750 ATGGATTCGTTTTCCTTTGCTGG - Intergenic
1098871793 12:75824889-75824911 GTGGACTGCCTTTGCTTTTATGG + Intergenic
1102897821 12:116612568-116612590 CTGGACTCCTTTTCCTTTTCCGG + Intergenic
1107583220 13:41815072-41815094 GTTTACTCACTTTCCTTTTTGGG - Intronic
1108593396 13:51930083-51930105 GTTCACTGGCTTTCCTTTTGGGG + Intergenic
1109534784 13:63701031-63701053 GTGGATTCTCTTGCCTTTCCTGG + Intergenic
1110703853 13:78581331-78581353 TTGCACTGTCTTTCCTTTTCTGG - Intergenic
1112322135 13:98417423-98417445 GTGGCCTCTGTTTCCTTTGCTGG - Intronic
1114850950 14:26381966-26381988 GGGGCCTCGCTTTCCTTATTAGG + Intergenic
1121661097 14:95635790-95635812 GTGGAGTCTCTGTTCTTTTCTGG + Intergenic
1122406589 14:101504583-101504605 GTGGCCTCCCTTTCCCTCTCTGG - Intergenic
1202938294 14_KI270725v1_random:114373-114395 GTTGACTACCTTGCCTTTTCTGG + Intergenic
1128296107 15:66521212-66521234 GTGGGCCCTATTTCCTTTTCGGG + Intronic
1128506529 15:68277222-68277244 CGGGACTCGCTTTCCTTCCCAGG + Intergenic
1136776347 16:32873834-32873856 GAGGACTCGCTTGCCTTCTCTGG + Intergenic
1136894267 16:33987678-33987700 GAGGACTCGCTTGCCTTCTCTGG - Intergenic
1140541246 16:75758390-75758412 GGTGACTCACTTTCGTTTTCAGG + Intronic
1142434722 16:90048882-90048904 GTGGACTGGCTGTCCTGCTCTGG + Intergenic
1203078762 16_KI270728v1_random:1135943-1135965 GAGGACTCGCTTGCCTTCTCTGG + Intergenic
1145863586 17:28226732-28226754 TGGGACTCCCTTTCCTTTCCAGG + Intergenic
1154250141 18:12737588-12737610 GCGAACCCGCTTTCCTTTCCCGG + Intergenic
1156262738 18:35459925-35459947 GTGCCCTCGCTTTCCTTCCCTGG - Intronic
1157787420 18:50496861-50496883 GTGTACACAGTTTCCTTTTCAGG - Intergenic
1160121957 18:76138851-76138873 TTGGACTCTCCTTCCTTCTCTGG + Intergenic
1160783279 19:887881-887903 GGGGACTGGGTTTCCTTTTCGGG + Intronic
1166174321 19:41055192-41055214 GTGGACTCACCTTCCACTTCAGG + Intergenic
1166177559 19:41085769-41085791 TTGGCCTCAGTTTCCTTTTCTGG - Intergenic
1168706283 19:58472086-58472108 GTGGGCTCGGTTTCCTTCGCTGG - Exonic
926907681 2:17821253-17821275 GTGGAGTCGCCTCCCTTATCGGG + Intergenic
929864368 2:45705637-45705659 GTGGGCTTGCTTTCCTTTTGTGG + Intronic
938080013 2:128364853-128364875 GTGGGCTCCCTTGCCTTTGCTGG + Intergenic
938695171 2:133828382-133828404 CTGGACTCCCTCTCTTTTTCTGG - Intergenic
941215314 2:162700097-162700119 GTGTATTTCCTTTCCTTTTCAGG + Intronic
944912313 2:204322697-204322719 CTGCACTCTCTTTCCTTTTCTGG - Intergenic
945670181 2:212793131-212793153 GTAGCCTAGCTTTCCTGTTCTGG - Intergenic
947235996 2:227941401-227941423 GTGGATTCTCTTGGCTTTTCTGG + Intergenic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
1173322144 20:41997905-41997927 GGGGACTTGGCTTCCTTTTCTGG + Intergenic
1174214748 20:48907744-48907766 GGGTACTGGCTTTCATTTTCAGG - Intergenic
1175466312 20:59192915-59192937 GGGGACTGGCTTTCATTTTCTGG - Exonic
1181772436 22:25135725-25135747 GTGCTCTCCCTGTCCTTTTCTGG - Intronic
949690555 3:6632438-6632460 GTGGACTAGCTTTGGTTTTATGG - Intergenic
961099356 3:124185550-124185572 GAGGACTCGCCTTCCTTGGCAGG + Intronic
962230568 3:133661956-133661978 GCGGCCGCGCTTGCCTTTTCCGG + Intergenic
964393099 3:156217976-156217998 GTGGATTCCCTCTGCTTTTCTGG - Intronic
965330664 3:167370706-167370728 GTGGCCTTGCTTTCCCTTTATGG - Intronic
965605523 3:170494467-170494489 GGGGTCTCCCTTTCCTTCTCAGG - Intronic
969398796 4:6939922-6939944 GGGGACTGGCCTTGCTTTTCAGG + Intronic
970827712 4:20296786-20296808 CTGCACTTGCTTTTCTTTTCGGG - Intronic
978884902 4:113757106-113757128 GTTTAGTCTCTTTCCTTTTCTGG - Intronic
982222644 4:153138067-153138089 CTGGCCTCGCTCTCCTTTTTTGG - Intergenic
982404899 4:155008785-155008807 GTGGACTTCTTTGCCTTTTCTGG + Intergenic
984066523 4:175055002-175055024 GTGGACTCTCTTACTTTTTCTGG - Intergenic
992269174 5:75048661-75048683 GTGGAAATGCTTTCCTTTTTGGG - Intergenic
995591105 5:113700336-113700358 CTGCTCTCCCTTTCCTTTTCAGG + Intergenic
996575229 5:124971438-124971460 GGGGAGTTTCTTTCCTTTTCTGG - Intergenic
996598047 5:125227485-125227507 GAGCACTCTCTTTCCATTTCTGG + Intergenic
1004491189 6:16117890-16117912 GTGTTCTCGCTTACATTTTCTGG - Intergenic
1007585594 6:42987111-42987133 GTGAACTCTCCTTTCTTTTCTGG + Intronic
1010479979 6:76338757-76338779 GTGGATTCTCTTGGCTTTTCTGG + Intergenic
1010606917 6:77901728-77901750 TTTGACTAGCTTTTCTTTTCTGG + Intronic
1012555292 6:100504400-100504422 TTGGATTAGCTTTCTTTTTCTGG - Intergenic
1015644338 6:135369313-135369335 GTGGATTCTCTTGGCTTTTCTGG + Intronic
1015825915 6:137311819-137311841 GTGGGCTTGCTTTCCTGATCGGG + Intergenic
1022616530 7:31936640-31936662 GTGTAGTCACTTTGCTTTTCTGG + Intronic
1024508832 7:50186441-50186463 GCCGATTCACTTTCCTTTTCTGG + Intergenic
1030434453 7:109498986-109499008 CTGTTCTCTCTTTCCTTTTCTGG + Intergenic
1031974976 7:128087880-128087902 GTAGACTGGCTTTCTGTTTCTGG - Intronic
1033920077 7:146380023-146380045 GTGTATTCTCTTTCCTTTTCAGG + Intronic
1036588656 8:10147950-10147972 GGAGACTCGCTTCCCCTTTCCGG - Intronic
1038715254 8:29985743-29985765 GTAGACTCGTTTTTCTTTCCTGG + Intergenic
1041526135 8:58808269-58808291 GCGGACTTGCTTTCCCTTTCAGG - Exonic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1043065246 8:75561250-75561272 GTGGACACGTTTTCCTTCGCTGG + Intronic
1049705921 8:144042067-144042089 GTGTACTCTTTTTCTTTTTCAGG - Intronic
1055835039 9:80429969-80429991 GTGGTCTCTCTTCACTTTTCCGG - Intergenic
1056426667 9:86484294-86484316 GTGGCCTGGCTTTCATTTTTTGG - Intergenic
1056478772 9:86979876-86979898 GTGTACTTGCTTTCATTTCCTGG + Intergenic
1059504352 9:114784313-114784335 ATGGCCTCTCTTTCTTTTTCAGG + Intergenic
1187095045 X:16139303-16139325 GTGGACTCGCTTTCCTTTTCAGG + Intronic
1187137761 X:16564802-16564824 GTGCAGCCACTTTCCTTTTCTGG + Intergenic
1191138502 X:57092124-57092146 GTGGATTCTCTTGGCTTTTCTGG - Intergenic
1193366305 X:80637924-80637946 GTGGATTCTCTTGGCTTTTCTGG - Intergenic
1195410702 X:104565976-104565998 CGGGACACGCTTTCCTTCTCCGG + Intergenic
1196194821 X:112828630-112828652 GTGGTCTCCCTTTCCAGTTCTGG - Intronic
1196948947 X:120856962-120856984 GTGGATTCTCTCTCCTTTGCTGG - Intergenic
1197081819 X:122426804-122426826 GTGGATTCTCTTCGCTTTTCTGG + Intergenic
1197098679 X:122625667-122625689 GTTTACTTGCTTTCCTTTACAGG - Intergenic
1197671929 X:129286453-129286475 GTGGACTGGTTTTGCTTTTCAGG - Intergenic
1200103522 X:153700208-153700230 GAGGACTCGCTTGCCTTCTCTGG - Intergenic