ID: 1187095275

View in Genome Browser
Species Human (GRCh38)
Location X:16141458-16141480
Sequence GTGAAAAATGGCACCAGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 490
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 472}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187095275_1187095281 28 Left 1187095275 X:16141458-16141480 CCTTCACTGGTGCCATTTTTCAC 0: 1
1: 0
2: 2
3: 15
4: 472
Right 1187095281 X:16141509-16141531 GATGACCACTGCTGGCCCTGAGG 0: 1
1: 0
2: 1
3: 20
4: 172
1187095275_1187095278 -10 Left 1187095275 X:16141458-16141480 CCTTCACTGGTGCCATTTTTCAC 0: 1
1: 0
2: 2
3: 15
4: 472
Right 1187095278 X:16141471-16141493 CATTTTTCACCTTGGCTCTAAGG 0: 1
1: 0
2: 3
3: 10
4: 193
1187095275_1187095280 20 Left 1187095275 X:16141458-16141480 CCTTCACTGGTGCCATTTTTCAC 0: 1
1: 0
2: 2
3: 15
4: 472
Right 1187095280 X:16141501-16141523 CTCACTCAGATGACCACTGCTGG 0: 1
1: 0
2: 0
3: 19
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187095275 Original CRISPR GTGAAAAATGGCACCAGTGA AGG (reversed) Intronic
901959649 1:12815068-12815090 TTGAAAACTGGCACCAGACAGGG - Intergenic
903317316 1:22518469-22518491 GTGACAAATGGCATCTGAGAGGG - Intronic
903554755 1:24185487-24185509 TTGCAAAATGGCATCAGGGAGGG + Intronic
905186231 1:36198964-36198986 CTGTAAAATGGCAAGAGTGAAGG + Intergenic
905542254 1:38769265-38769287 TTGAAAACTGGCACAAGAGAGGG + Intergenic
906755748 1:48312931-48312953 GTAAGAAAGGGCATCAGTGATGG + Intronic
908658171 1:66410172-66410194 TTGAAAATTGGCACAAGAGAAGG + Intergenic
909210336 1:72814941-72814963 TTGAAAACTGGCACAAGAGAAGG - Intergenic
909242978 1:73238583-73238605 TTGAAAACTGGCACAAGAGAGGG + Intergenic
909310105 1:74135255-74135277 GTAAAAAGTGGCACAATTGAGGG + Intronic
910102723 1:83595850-83595872 GACAAAAATGGCATCAGTGAGGG + Intergenic
910407550 1:86905637-86905659 ATGAAAACTGTCACAAGTGAGGG - Intronic
910915469 1:92283546-92283568 TTGAAAAATGGCACAAGACAAGG + Intronic
911104962 1:94122446-94122468 GTGAAACATGGCTGGAGTGAAGG + Intergenic
911130912 1:94387306-94387328 GTGGAAACTGGAAGCAGTGATGG + Intergenic
912462150 1:109842296-109842318 TTGAAAAATGGCACAAGACAGGG + Intergenic
912687387 1:111778177-111778199 GTGGAACATGGCACCAGTGCTGG - Intronic
913130297 1:115832995-115833017 GCTGAAAATGGCACTAGTGAGGG + Intergenic
913186843 1:116376257-116376279 GGGAAAAAAGGTTCCAGTGAAGG + Intronic
914969746 1:152297063-152297085 TTGAAAACTGGCACAAGAGAGGG + Intergenic
916293509 1:163191505-163191527 GTCTAAAATGGGAGCAGTGAAGG + Intronic
916317073 1:163461002-163461024 ATCAAATATGGCAACAGTGATGG - Intergenic
916545761 1:165802651-165802673 TTGAAAATTGGCACCAGACAAGG + Intronic
917046756 1:170869246-170869268 GTGAAAACTGGCACAAGACATGG - Intergenic
917650565 1:177072794-177072816 GTGAGGAGTGGCACCACTGATGG - Intronic
917706274 1:177637861-177637883 TTGAAAACTGGCACAAGAGAGGG + Intergenic
918138352 1:181698387-181698409 GTGAACCAAGGCACCAGTCATGG - Intronic
918379607 1:183940963-183940985 TAGCAAAATGGCCCCAGTGATGG - Intronic
918614432 1:186528235-186528257 TTGAAAACTGGCACAAGAGAAGG - Intergenic
919082600 1:192884630-192884652 GGGATAAATGTCAACAGTGATGG - Intergenic
919332514 1:196189625-196189647 TTGAAAACTGGCACAAGAGAGGG - Intergenic
920639132 1:207734405-207734427 GTGAAAACTGGCACAAGACAGGG + Intronic
921184940 1:212662105-212662127 TTGAAAACTGGCACAAGAGAGGG + Intergenic
921208900 1:212875456-212875478 GAAGAAAATGGCACCAGCGAGGG + Intronic
922115826 1:222613265-222613287 ATCAAAAATGACACTAGTGATGG - Intergenic
922399255 1:225235109-225235131 TTGAAAACTGGCACAAGAGAAGG - Intronic
923136313 1:231123209-231123231 GTGAAGAATGTTCCCAGTGAAGG - Intergenic
923230802 1:231984521-231984543 ACGAAACATGGAACCAGTGATGG + Intronic
924326721 1:242902043-242902065 GTGATGAATGGCACCACTGTAGG - Intergenic
1063840907 10:10071440-10071462 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1064150482 10:12859677-12859699 TTGAAAACTGGCACCAGACAGGG + Intergenic
1064176147 10:13076936-13076958 TTGAAAACTGGCACAAGAGAGGG + Intronic
1065660014 10:27996743-27996765 TTGGAAAATGACACCATTGATGG + Intronic
1066360263 10:34723373-34723395 GAGAAAAAGGCCACCAATGATGG + Intronic
1066787976 10:39027029-39027051 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1067050741 10:43018172-43018194 TTGAAAACTGGCACAAGTCAAGG - Intergenic
1067795941 10:49322310-49322332 GTGGAAAATGGTGCCTGTGAGGG - Intronic
1068372037 10:56129721-56129743 GTGAAAACTGGCACAAGACAAGG + Intergenic
1069073834 10:64017443-64017465 GTGAAAACTGGCACAAGACAGGG - Intergenic
1069161948 10:65103825-65103847 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1069360835 10:67639933-67639955 TTGAAAACTGGCACAAGTCAGGG + Intronic
1071028271 10:81141135-81141157 CTGAAAAATGGCACAAGACAAGG + Intergenic
1071781260 10:88847868-88847890 GTAAAAAATGGCACCTGTGCAGG - Intronic
1072374158 10:94797056-94797078 TTGAAAACTGGCACAAGTCAGGG - Intronic
1072388438 10:94956972-94956994 TTGAAAACTGGCACAAGTCAGGG - Intronic
1074254929 10:111792479-111792501 GTGAAAACTGGCACAAGACAGGG + Intergenic
1074280033 10:112042660-112042682 GTGAAAACTGGCACAAGACAGGG + Intergenic
1075495905 10:122918226-122918248 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1076030056 10:127149720-127149742 GTGAACACTGGCAGCTGTGATGG + Intronic
1076475954 10:130751577-130751599 GTGAAGAGTGGCATCAGAGAAGG + Intergenic
1078115673 11:8447713-8447735 TTGAAAAATGGCACAAGACAAGG + Intronic
1078429397 11:11276597-11276619 GTGAAAACTGGCACAAGACAGGG - Intronic
1078526575 11:12106016-12106038 GAGAAAAATGGCACCTGTCTGGG - Intronic
1079325215 11:19485582-19485604 TTTAAATATGGCACCAGGGAAGG + Intronic
1079463172 11:20702574-20702596 TTGAAAACTGGCACAAGAGAGGG - Intronic
1080559215 11:33446880-33446902 GTGAAATATAGCAGAAGTGATGG - Intergenic
1081209003 11:40308764-40308786 AAGAAAAATGTCAGCAGTGACGG + Intronic
1081579892 11:44344952-44344974 GTGAAGAATAGCACCAGAGCAGG - Intergenic
1082099421 11:48159826-48159848 TTGAAAACTGGCATCAGAGATGG - Intronic
1082606023 11:55234891-55234913 GTGAAAATTGGCACAAGACAGGG - Intergenic
1082796617 11:57382483-57382505 GAGAAAAATGGCCCCAGTTGAGG + Intergenic
1083532727 11:63439237-63439259 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1083601665 11:63952502-63952524 GTGAGAAAAGGCAACAGGGACGG - Exonic
1086574484 11:88323346-88323368 GTGAAAACTGGCACAAGACAAGG + Intronic
1086841086 11:91684981-91685003 GTAAAACATGGCAGCAGTGCTGG + Intergenic
1088429039 11:109737200-109737222 GAGAAAAATGGCACCAAAAAAGG + Intergenic
1090244987 11:125209839-125209861 GTGAAGAATGACACCAGGGTGGG - Intronic
1090902027 11:131040811-131040833 GTGAAAGATGACATAAGTGATGG + Intergenic
1091021206 11:132101758-132101780 GTGAATTATGGCAACAGTTAAGG - Intronic
1091299054 11:134494336-134494358 GTGAAAACTGGCACAAGACAGGG - Intergenic
1091564533 12:1638907-1638929 GTGAGAAATGGCATCTGTGAGGG + Intronic
1091787654 12:3252646-3252668 GTGAAACATTGGACCAGGGAAGG - Intronic
1092010927 12:5111927-5111949 GTAAAAAATGCCACCAGTCTGGG - Intergenic
1094418584 12:30244985-30245007 GTGTAAAATGGCAACAATAATGG + Intergenic
1094733435 12:33204542-33204564 GATAAAAATGACAGCAGTGATGG - Intergenic
1094862209 12:34480370-34480392 TTGAAAACTGGCACAAGTCAGGG + Intergenic
1095033084 12:37319946-37319968 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1096894400 12:54806378-54806400 TTGAAAACTGGCACAAGAGAAGG - Intergenic
1097824916 12:64165529-64165551 TTGAAAACTGGCACCAGACAAGG + Intergenic
1098421332 12:70301285-70301307 TTGAAAACTGGCACAAGAGAAGG - Intronic
1098892260 12:76021471-76021493 ATCAAAGATGGCACCAGTGGAGG - Intergenic
1099394860 12:82125170-82125192 TTGAAAACTGGCACCAGACAAGG + Intergenic
1100403146 12:94249911-94249933 GAGAAAAAAAGCACCAGTGTGGG + Intronic
1102001998 12:109563224-109563246 GGGAGAAATGGCACCAGTTTGGG + Intronic
1102397395 12:112598617-112598639 GTGAAAAATTGCAGCAGGCAGGG + Intronic
1103032196 12:117625267-117625289 TTGAAAACTGGCACAAGTCAGGG - Intronic
1104255320 12:127131207-127131229 GTGGCAATTGGCACCAATGACGG - Intergenic
1104302413 12:127576367-127576389 GTGAAAAATGTGACCAGGGTGGG + Intergenic
1105237571 13:18572698-18572720 GTAAAAAATGGCACAAGAGCAGG - Intergenic
1105510976 13:21051541-21051563 TTGAAAAATGGGGCCAGTGGTGG + Intronic
1106018813 13:25895099-25895121 TTGAAAAATGGCACAAGACAGGG - Intronic
1107951911 13:45470616-45470638 GTGCAAAATGTTACCATTGAGGG - Intronic
1108329422 13:49370402-49370424 GTGAAAAATACGACCACTGATGG + Intronic
1108858457 13:54824445-54824467 TTGAAAACTGGCACAAGAGAAGG + Intergenic
1110466977 13:75813460-75813482 GTGAAAACTGGCACCATGGCTGG + Intronic
1110891250 13:80701283-80701305 TTGAAAACTGGCACCAGACAGGG - Intergenic
1111999744 13:95199269-95199291 GTGAAAAATGGCATCAGGAGAGG - Intronic
1112410866 13:99162624-99162646 GTGCAAACTGCCTCCAGTGAGGG + Intergenic
1114932768 14:27494363-27494385 TTGAAAACTGGCACAAGTCAAGG + Intergenic
1115747636 14:36453539-36453561 CTGAAAAATCGCCCCAATGATGG - Intergenic
1115969109 14:38925732-38925754 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1117204534 14:53427834-53427856 TTGAAAACTGGCACAAGAGAAGG + Intergenic
1119208044 14:72809383-72809405 GGGGAACATGGCACCGGTGAAGG + Intronic
1120993821 14:90399752-90399774 GTGAAAAATGGCACCTCTAGTGG - Intronic
1122335227 14:100971130-100971152 GTGAAAATTGAGACCAATGATGG + Intergenic
1123392643 15:19892253-19892275 GTGAAAACTGGCACAAGACAGGG + Intergenic
1123454971 15:20413553-20413575 GTGAAAACTGGCACAAGACAGGG - Intergenic
1125765109 15:42130439-42130461 GTGATAAAGGGCGCCAGGGAAGG + Intergenic
1127179799 15:56403061-56403083 TTGAAAACTGGCACAAGAGAAGG + Intronic
1127934060 15:63619060-63619082 TTGAAAACTGGCACAAGAGAGGG - Intronic
1129450851 15:75650415-75650437 GTGAGAAATGGCACTGTTGAGGG - Exonic
1130452977 15:84076157-84076179 GTGAAAACTGGCACAAGACAGGG + Intergenic
1130475834 15:84266166-84266188 GTGAAAACTGGCACAAGACAGGG - Intergenic
1130483254 15:84380220-84380242 GTGAAAACTGGCACAAGACAGGG - Intergenic
1130899571 15:88196980-88197002 TTGAAACATGGCAGCAGAGATGG + Intronic
1130947097 15:88556300-88556322 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1133956557 16:10448875-10448897 TTGAAAACTGGCACAAGAGAAGG - Intronic
1134383823 16:13753218-13753240 ATAAAAAATGGCAAAAGTGATGG + Intergenic
1134827796 16:17298398-17298420 CTGTAAAATGGGAACAGTGAGGG - Intronic
1134903883 16:17962770-17962792 GTGAAACAGGGAATCAGTGATGG - Intergenic
1138361490 16:56432904-56432926 GTGTAAGATGTGACCAGTGAGGG - Intronic
1138875128 16:60939983-60940005 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1139395970 16:66639519-66639541 GAGAAAAATGGAAGCAGGGAAGG + Intronic
1147153801 17:38533240-38533262 GGGAGAAATGGCAGGAGTGAGGG + Exonic
1149395445 17:56236836-56236858 TTGAAAACTGGCACAAGTCAAGG - Intronic
1153026400 18:676764-676786 GTGATAAATGGGACCCTTGAGGG - Intronic
1154127073 18:11701136-11701158 GAGATAAATGGCAACAGTGTGGG + Intronic
1154979957 18:21495374-21495396 GTGAAATATCCCACTAGTGATGG - Intronic
1155568151 18:27160174-27160196 GTGAAAACTGGCACAAGACAGGG - Intronic
1156715246 18:40000839-40000861 GGGTAAAATGGCACCAGTGCTGG - Intergenic
1158469527 18:57723175-57723197 TTGAAAACTGGCACAAGTCAGGG + Intronic
1158568147 18:58572941-58572963 TTGTAAAATGTCACCATTGAGGG + Intronic
1159126292 18:64228448-64228470 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1160389853 18:78521827-78521849 GTGACAGAAGGCAACAGTGATGG - Intergenic
1161089927 19:2354631-2354653 GTACAAAATGGCTTCAGTGAAGG - Intronic
1162344701 19:10112433-10112455 GTGAGCACTGGCACCAGTAATGG + Intronic
1162457768 19:10796285-10796307 GGGAGAAAAGGCACCAGTGGGGG - Intronic
1164051969 19:21591458-21591480 GTGAAAAGTGTCAGCAGAGAAGG + Intergenic
1164139393 19:22444110-22444132 TTGAAAAATGGCACAAGACAAGG - Intronic
1166370069 19:42295459-42295481 ATGCAAAATGGCTCCTGTGAGGG + Exonic
925050565 2:811630-811652 ATATAAAATGGCAGCAGTGATGG - Intergenic
929298160 2:40271498-40271520 GTGAAAAATAGGTTCAGTGAGGG - Intronic
929558027 2:42937542-42937564 GTGGAAAATGGCCCCAGGGACGG - Intergenic
930667989 2:54118328-54118350 GAGACAAATGGCAGTAGTGAAGG + Intronic
930871391 2:56174624-56174646 GTGAAAACTGGCACAAGACAGGG + Intergenic
931048433 2:58383603-58383625 TTGAAAAATGGCACAAGACAGGG - Intergenic
931499553 2:62849989-62850011 GGGAAAAATGGGACCTATGATGG + Intronic
931844133 2:66185280-66185302 GTGCTACATGGCACCAGTGGTGG + Intergenic
931888546 2:66644682-66644704 GTGAAAACTGGCACAAGACAGGG - Intergenic
932874293 2:75433904-75433926 TTGAAAACTGGCACAAGAGAAGG + Intergenic
933472801 2:82748559-82748581 TTGAAAACTGGCACAAGAGAAGG - Intergenic
934872184 2:97876778-97876800 TTGAAAACTGGCACCAGACAAGG + Intronic
935428219 2:102943625-102943647 GTGAAAAATGGCATCAGTGTTGG + Intergenic
935737858 2:106120499-106120521 GTGAGAAATGGCACCGAGGAAGG - Intronic
936782494 2:116051009-116051031 TTGAAAAATGGCACAAGACAGGG - Intergenic
936788333 2:116121773-116121795 TTGAAAACTGGCACAAGTCAGGG - Intergenic
936873389 2:117159964-117159986 TTGAAAAATGGCACAAGACAGGG + Intergenic
937489206 2:122348035-122348057 TTGAAAACTGGCACCAGACAGGG - Intergenic
938108488 2:128549149-128549171 GTGAAAACTGAGACCAGAGAGGG - Intergenic
938551851 2:132390028-132390050 GAGAAAAATGGCACTAATGAGGG - Intergenic
938720943 2:134065979-134066001 TTGAAAACTGGCACAAGAGAGGG + Intergenic
939623513 2:144448870-144448892 GTGAGAAATGCCACTAGTAAGGG + Intronic
940527906 2:154840998-154841020 TTGAAAACTGGCACCAGACAAGG - Intronic
941108660 2:161392815-161392837 GTGAAAAATGGCACCATTCAGGG + Intronic
942304012 2:174588651-174588673 GGGAGAAATGGCAACAGTCATGG + Intronic
942859048 2:180587691-180587713 TTGAAAAATGGCACAAGACAGGG - Intergenic
945005823 2:205404807-205404829 GTGAAAAATGGCAACAGTCTGGG - Intronic
947244803 2:228034957-228034979 TTGAAAACTGGCACAAGAGAGGG + Intronic
1168867056 20:1095695-1095717 GTGAAAAATGGAAACAGTAATGG + Intergenic
1169003217 20:2183546-2183568 CAGAAAAATGACTCCAGTGATGG + Intergenic
1169174537 20:3498759-3498781 TTGAAAACTGGCACAAGTCAGGG + Intronic
1169537883 20:6565446-6565468 TTGAAAAATTGAACCAGTTATGG - Intergenic
1170014306 20:11763886-11763908 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1170651533 20:18247004-18247026 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1171110616 20:22478124-22478146 TTGAAAACTGGCACCAGACAAGG + Intergenic
1171404888 20:24904535-24904557 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1171407964 20:24925818-24925840 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1171472222 20:25381266-25381288 GAGGAAAATGGTGCCAGTGAGGG - Intronic
1171763656 20:29236403-29236425 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1171825786 20:29902841-29902863 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1171912103 20:30972517-30972539 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1173030066 20:39348375-39348397 GTGAAATACGGCACCACTAAAGG + Intergenic
1173935170 20:46855361-46855383 ATGAAAAATGGGACCAATAATGG + Intergenic
1175287992 20:57850719-57850741 TTGAGTAATGGCACCAGTCAGGG + Intergenic
1176319336 21:5294456-5294478 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1176588050 21:8609203-8609225 GTGAAAACTGGCACAAGACAGGG + Intergenic
1176781561 21:13200975-13200997 GTAAAAAATGGCACAAGAGCAGG - Intergenic
1176928802 21:14782990-14783012 TTGAAAAATGGCACAAGACAGGG + Intergenic
1177094473 21:16815483-16815505 GTGTAAAATGAAACCACTGAAGG - Intergenic
1177979260 21:27890124-27890146 GTAAAAAATGGCACAAGAGCAGG - Intergenic
1178219587 21:30641042-30641064 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1178252788 21:31020656-31020678 GTGACAAATGGGGACAGTGAAGG + Intergenic
1180270882 22:10586202-10586224 GTGAAAACTGGCACAAGACAGGG + Intergenic
1180570331 22:16710649-16710671 TTGAAAACTGGCACAAGAGAAGG + Intergenic
1182261376 22:29074289-29074311 GAGAAAAAAGGAAGCAGTGATGG + Intronic
1203331287 22_KI270738v1_random:93802-93824 TTGAAAACTGGCACAAGAGAGGG + Intergenic
949139299 3:612535-612557 GTGAAAACTGGCACAAGACAGGG - Intergenic
949592971 3:5512896-5512918 TTGAAAACTGGCACCAGAGAAGG + Intergenic
949816177 3:8060753-8060775 TTGAAAACTGGCACAAGAGAGGG - Intergenic
950175380 3:10869840-10869862 GTGATGAATGGCACCAGCAATGG + Intronic
950299519 3:11864047-11864069 TTGAAAACTGGCACAAGAGAGGG - Intergenic
950383703 3:12639298-12639320 TTGAAAACTGGCACCAGATAGGG + Intronic
950547169 3:13645409-13645431 GCTAAAGATGGCACCAGTGGTGG + Intergenic
950908344 3:16559745-16559767 CTGAAAAAGGGCATCTGTGATGG + Intergenic
951348804 3:21579777-21579799 GAGACAAAGGGCACCAGAGACGG - Intronic
951963472 3:28354929-28354951 GTGAAAACTGGCACAAGACAGGG + Intronic
951964373 3:28366208-28366230 GTGAAAACTGGCACAAGACAGGG - Intronic
954150435 3:48654614-48654636 GTGCAAAGGGGCACCCGTGATGG + Intronic
954893817 3:53958237-53958259 TGGAAAAATGGCAACAGAGAAGG - Intergenic
955533657 3:59900497-59900519 GTGTGAAGTGGCACCAGGGATGG - Intronic
957108232 3:75919102-75919124 TTGAAAACTGGCACAAGAGAAGG - Intronic
957723605 3:84035731-84035753 TTGAAAAATGGCACAAGACAAGG + Intergenic
957773650 3:84727383-84727405 GAGAAAAATGGAACAAGTGCTGG - Intergenic
957905367 3:86546422-86546444 TTGGAAAATGGCAGCAGTGTTGG - Intergenic
958052886 3:88370540-88370562 GAGAAAAATGGAGCCAGGGAAGG - Intergenic
958204420 3:90371436-90371458 TTGAAAACTGGCACAAGAGAGGG - Intergenic
958473595 3:94552516-94552538 TTGAAAACTGGCACAAGAGAGGG + Intergenic
958627227 3:96641643-96641665 TTGAAAACTGGCACAAGAGAGGG - Intergenic
959464559 3:106669238-106669260 TTGAAAACTGGCACAAGAGAGGG + Intergenic
959531569 3:107439794-107439816 GTGGATAATGGCAGCAGTGGAGG + Intergenic
959623494 3:108424029-108424051 GTGAAAAATGGCATCTGTTTAGG + Intronic
959990416 3:112625194-112625216 GTGAAAAATGGTATCAGTATAGG - Intronic
960793247 3:121456309-121456331 GTGAAAACTGGCACAAGACAGGG + Intronic
961179171 3:124862726-124862748 GGGAAAACTGCTACCAGTGAAGG - Intronic
961291863 3:125853884-125853906 TTGAAAACTGGCACCAGACAGGG + Intergenic
962356829 3:134701653-134701675 TTGAAAAATGGCACAAGACAAGG + Intronic
962439342 3:135397927-135397949 TTGAAAACTGGCACAAGAGAGGG - Intergenic
963587715 3:147214226-147214248 TTGAAAAATGACACCAGAGTAGG + Intergenic
963778801 3:149466135-149466157 GGGAACAAAAGCACCAGTGAGGG + Intergenic
964150719 3:153520842-153520864 TTGAAAAATGGCACAAGACAGGG + Intergenic
964161924 3:153655940-153655962 TTGAAAAATGGCACAAGACAGGG + Intergenic
964390897 3:156196866-156196888 TTGAAAATTGGCACAAGTCAGGG - Intronic
964457168 3:156881076-156881098 TTGAAAACTGGCACAAGAGAGGG + Intronic
964657748 3:159086982-159087004 GTGAAAACTGGCACAAGACAGGG - Intronic
965709816 3:171545921-171545943 TTAAAACATGGCACCAGAGAAGG - Intergenic
969046673 4:4341414-4341436 TTGAACAATGGCCACAGTGAAGG + Intergenic
969547977 4:7844434-7844456 GTGACAAATGCCACCACTGGGGG - Intronic
970120983 4:12752206-12752228 TTGAAAACTGGCACAAGAGAGGG + Intergenic
970214166 4:13741467-13741489 GTGAAAACTGGCACAAGACAAGG - Intergenic
970288279 4:14542970-14542992 GTGAAAACTGGCACAAGGCAAGG + Intergenic
971437611 4:26644499-26644521 TTGAAAACTGGCACAAGAGAGGG + Intronic
971438277 4:26651777-26651799 TTGAAAACTGGCACAAGAGAGGG - Intronic
971593019 4:28493302-28493324 TTGAAAACTGGCACAAGTCAAGG + Intergenic
971717296 4:30195376-30195398 GTGAAAAAGTACATCAGTGAAGG + Intergenic
971904720 4:32711598-32711620 GTGACATCTGGCACCAGTGAGGG + Intergenic
972021234 4:34316478-34316500 GTGAAAGGTGTCACCAGTGGAGG + Intergenic
972691388 4:41402097-41402119 GTGAAAACTGGCACAAGACAGGG - Intronic
972996333 4:44883513-44883535 TTGAAAACTGGCACAAGAGAGGG + Intergenic
973347889 4:49076411-49076433 TTGAAAAATGGCACAAGACAGGG + Intergenic
973860472 4:55059699-55059721 TTGAAAACTGGCACAAGAGAGGG + Intergenic
974095866 4:57363213-57363235 CTGAAAAATGGCATTTGTGAGGG - Intergenic
974143864 4:57922147-57922169 TTGAAAACTGGCACCAGACAAGG + Intergenic
974246881 4:59331690-59331712 TTGAAAACTGGCACAAGAGAGGG + Intergenic
974303105 4:60095734-60095756 GTGTACAATGGAACCACTGATGG - Intergenic
974362155 4:60895142-60895164 GTGAAAGATGGCAGCATTGGAGG - Intergenic
974534826 4:63161653-63161675 ATGAGAAATGGCACAAGTAAAGG + Intergenic
974711425 4:65601640-65601662 GAGAAAAATGGCACCTGTCAAGG - Exonic
974877495 4:67716713-67716735 GTGGGAAATGGCACCCGTGGTGG + Intergenic
975246237 4:72123840-72123862 TTGAAAACTGGCACAAGTCAGGG + Intronic
975247787 4:72140322-72140344 TTGAAAACTGGCACAAGTCAGGG - Intronic
975531599 4:75405138-75405160 TTGAAAAATGGCACAAGACAGGG + Intergenic
975625641 4:76343930-76343952 TTGAAAACTGGCACAAGAGAAGG + Intronic
976371217 4:84290493-84290515 TTGAAAACTGGCACAAGTCAAGG + Intergenic
976713052 4:88093598-88093620 GGGAAAAATGGGACCAGATAAGG - Intronic
976819431 4:89188443-89188465 GTAAAAACTGGCACAAGAGAAGG - Intergenic
977168175 4:93727050-93727072 TTGAAAACTGGCACAAGTCAGGG - Intronic
977426343 4:96871244-96871266 TTGAAAAATGGCACAAGACAGGG - Intergenic
977478338 4:97541046-97541068 TTGAAAAATGGCACAAGACAGGG + Intronic
978231375 4:106404516-106404538 TTGAAAACTGGCACAAGAGAGGG - Intergenic
978238557 4:106489362-106489384 ATGAAAACTGGCACAAGAGAGGG + Intergenic
978735559 4:112080257-112080279 GTGAAAAATGGACCCAGTAAGGG - Intergenic
980217638 4:129872807-129872829 TTGAAAACTGGCACAAGAGAGGG - Intergenic
980506931 4:133735998-133736020 TTGAAAAATGGCACAAGACAGGG - Intergenic
980561452 4:134481890-134481912 TTGAAAACTGGCACAAGAGAAGG - Intergenic
980587305 4:134833725-134833747 TTGAAAACTGGCACAAGAGAAGG + Intergenic
980605142 4:135079966-135079988 TTGAAAAATGGCACAAGACAGGG - Intergenic
980861513 4:138504537-138504559 TTGAAAACTGGCACAAGAGAAGG - Intergenic
981026362 4:140080751-140080773 ATGAAAAAAGGCAGCAATGATGG + Intronic
981221892 4:142246861-142246883 TTGAAAACTGGCACAAGTCAAGG - Intronic
981789270 4:148517969-148517991 TTGAAAACTGGCACCAGACAAGG - Intergenic
982599881 4:157435036-157435058 GGGCAAAATGCCACCAGGGAAGG + Intergenic
985891456 5:2718376-2718398 CTGAAAAGAGGCACCACTGAAGG + Intergenic
986254218 5:6088343-6088365 GAGCAAAGAGGCACCAGTGAGGG + Intergenic
987979440 5:25062733-25062755 GTGAGAAATGACACCAGTTGTGG - Intergenic
989828062 5:45883295-45883317 TTGAAAACTGGCACAAGAGAGGG - Intergenic
989941017 5:50149813-50149835 TTGAAAACTGGCACAAGAGAGGG + Intergenic
990229941 5:53702246-53702268 TTGAAAACTGGCACAAGAGAGGG - Intergenic
990657041 5:57968688-57968710 TTGAAAAATGGCACAAGACAGGG - Intergenic
991175154 5:63679041-63679063 GTGAAAACTGGCACAAGACAGGG - Intergenic
991416827 5:66401585-66401607 GTGAAAACTGGCACAAGACAAGG - Intergenic
991702783 5:69331727-69331749 GTGAAGAATGGCACCAATAGAGG - Intronic
993305103 5:86267110-86267132 TTGAAAACTGGCACAAGAGAGGG - Intergenic
993435223 5:87884643-87884665 TTGAAAACTGGCACAAGAGAGGG - Intergenic
994230201 5:97303044-97303066 TTGAAAACTGGCACAAGAGAGGG - Intergenic
994887118 5:105578375-105578397 GTGAAAACTGGCACAAGACAAGG - Intergenic
994917674 5:106001108-106001130 GTGAAAATTGGCACAAGACAAGG - Intergenic
995030053 5:107470213-107470235 CCAAAAAATGGCAACAGTGAGGG + Intronic
995483086 5:112612206-112612228 GTGGAAAATGCCACCATTCAGGG + Intergenic
995715137 5:115075075-115075097 TTGAAAACTGGCACCAGACAAGG + Intergenic
995923370 5:117340319-117340341 GTGAAAACTGGCACAAGACAGGG - Intergenic
996300741 5:121981248-121981270 CTGAAAAATGTAGCCAGTGAAGG + Intronic
997626687 5:135335968-135335990 CTGTAAAATGGGACCAGTAAGGG - Intronic
997920298 5:137972536-137972558 TTGAAAAATGGCACAAGACAGGG + Intronic
998931344 5:147184831-147184853 GTGAAAACTGGCACAAGACAGGG + Intergenic
999026182 5:148234546-148234568 TTGAAAACTGGCACAAGAGAGGG + Intergenic
999556169 5:152744879-152744901 TTGAAAACTGGCACAAGAGAGGG + Intergenic
999815563 5:155172411-155172433 TTGAAAACTGGCACAAGAGAGGG + Intergenic
999820702 5:155225206-155225228 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1000277475 5:159751130-159751152 CTGCAAAATGGGAACAGTGACGG + Intergenic
1001498761 5:172211670-172211692 GTGAAAAATTCCATCTGTGATGG - Exonic
1003534577 6:6965486-6965508 GTCAAAAAAGGCACCATAGAAGG + Intergenic
1004056424 6:12143462-12143484 TTGAAAAATGGCACAAGACAAGG + Intronic
1006616977 6:35336026-35336048 GTGAAAACTGGCACAAGACAGGG + Intergenic
1006617228 6:35338630-35338652 GTGAAAACTGGCACAAGACAGGG - Intergenic
1007134062 6:39504425-39504447 TTGAAAACTGGCACAAGAGAAGG + Intronic
1007151899 6:39701710-39701732 GTGAAATATGGAGCCACTGAAGG + Intronic
1007845454 6:44751498-44751520 TTGAAAACTGGCACAAGTCAGGG + Intergenic
1007845952 6:44756547-44756569 TTGAAAAATGGCACAAGACAGGG - Intergenic
1007857671 6:44874577-44874599 TTGAAAAATGGCACAAGACAGGG + Intronic
1007873346 6:45066388-45066410 TTGAAAAATGGCACAAGACAGGG + Intronic
1007963014 6:45978238-45978260 GGGAAAAAAGGCACCATAGATGG - Intronic
1007986861 6:46215959-46215981 CTGAAGAATGGAAACAGTGAAGG + Intergenic
1008061044 6:46997176-46997198 GTGAAATATGGCAAAAGTTATGG + Intergenic
1008088916 6:47273588-47273610 TTGAAAAATGGCACAAGACAAGG + Intronic
1008725098 6:54407887-54407909 TTGAAAAATGGCACAAGACAGGG - Intergenic
1009340726 6:62551426-62551448 TTGAAAACTGGCACCAGACAGGG - Intergenic
1009982868 6:70746237-70746259 GTGAAAACTGGCACAAGACAAGG - Intronic
1010054721 6:71551882-71551904 ATGAAATATGTCACTAGTGAAGG + Intergenic
1010396842 6:75402632-75402654 GTGATAAATGGTACCCCTGAAGG + Intronic
1011063616 6:83299665-83299687 TTGAAAACTGGCACAAGTCAAGG - Intronic
1011337788 6:86280210-86280232 GTGAAAACTGGCACAAGATAGGG - Intergenic
1011429660 6:87271835-87271857 TTGAAAACTGGCACGAGAGAAGG - Intergenic
1011999267 6:93633652-93633674 GTGAAAACTGGCACAAGACAGGG - Intergenic
1012766337 6:103370968-103370990 TTGAAAACTGGCACAAGAGAAGG + Intergenic
1013101969 6:106994846-106994868 TTGAAAAAGGGCATCACTGAAGG - Intergenic
1015909125 6:138148970-138148992 GTGAAAAAAGTCATCAGTGCTGG - Intergenic
1016005653 6:139086485-139086507 TTGAAAAATGGCACAAGACAGGG - Intergenic
1016437987 6:144057540-144057562 TTGGGAAATGGCACCAGTGCAGG - Intronic
1016777264 6:147918422-147918444 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1017059994 6:150474147-150474169 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1017809534 6:157974876-157974898 GTGAAAAATGAAACAAGTGAGGG - Intergenic
1018055734 6:160050678-160050700 GTCAAAAAATGCAGCAGTGAAGG - Intronic
1018342551 6:162867351-162867373 GGGAGAAATGGCAACAGGGATGG - Intronic
1018646353 6:165952250-165952272 GTGAAGAAAGGCACAGGTGAAGG - Intronic
1020103514 7:5408883-5408905 GGGAAAGATGGAACCACTGAGGG + Intronic
1022232347 7:28426409-28426431 TTGAGACAGGGCACCAGTGAAGG - Intronic
1023424100 7:40016075-40016097 GGGAGAAATGCCAGCAGTGAAGG + Intronic
1024950078 7:54851744-54851766 TTGAAAACTGGCACGAGAGAAGG - Intergenic
1025591259 7:62862851-62862873 TTGAAAACTGGCACAAGTCAGGG + Intergenic
1025597581 7:62950506-62950528 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1025831115 7:65050790-65050812 GTTAAAAATTCCACCAGTAATGG + Intergenic
1025918266 7:65884671-65884693 GTTAAAAATTCCACCAGTAATGG + Intronic
1028009031 7:85616655-85616677 TTGAAAACTGGCACAAGAGAAGG + Intergenic
1028118073 7:87024128-87024150 TTGAAAACTGGCACAAGAGAGGG - Intronic
1029052811 7:97707205-97707227 TTGAAAAATGGCACAAGACAAGG + Intergenic
1030258311 7:107536196-107536218 TTGAAAACTGGCACAAGTCAAGG + Intronic
1030295047 7:107916372-107916394 GTTAAAAATGTCATCAGTGCCGG + Intronic
1030548700 7:110931657-110931679 GTGATCATTGGCACCAGTGTGGG - Intronic
1031425851 7:121604922-121604944 GTGAAACATGGAACCAGAAATGG - Intergenic
1031548620 7:123081390-123081412 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1031703055 7:124948903-124948925 GTGAAAACTGGCACAAGACAAGG + Intergenic
1033441736 7:141386259-141386281 GTATAGAATGGCACCAGTGGAGG - Intronic
1033630403 7:143152313-143152335 GAGTAAAAGGGCACCAGTGTTGG - Intergenic
1033838229 7:145341796-145341818 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1033844432 7:145415032-145415054 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1033942435 7:146672255-146672277 GAGAAAAAGGGAAGCAGTGAGGG - Intronic
1034109615 7:148523585-148523607 GTGAAAAAGTGCATCTGTGAAGG + Intergenic
1034236578 7:149575874-149575896 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1034635513 7:152564293-152564315 GTGAAATATGGCCGCAGGGAGGG + Intergenic
1036241015 8:7081129-7081151 GTGAAAAAGGCAACCAGTGGGGG - Intergenic
1036972972 8:13375573-13375595 TTGAAAAATGGCACAAGACAGGG - Intronic
1037583018 8:20256970-20256992 GTGAAAAAGAGCAGCAGAGAAGG + Intronic
1038146186 8:24898310-24898332 AGGAAAAATGGCTTCAGTGAGGG + Intergenic
1039169486 8:34726305-34726327 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1039170751 8:34742114-34742136 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1039350424 8:36758041-36758063 GAGAAAAATTGCACCATTGCTGG - Intergenic
1040368201 8:46741952-46741974 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1040462529 8:47662584-47662606 GGGAATAATGGCACTGGTGAGGG - Intronic
1040606446 8:48937258-48937280 GAAAAAAGTGGCAGCAGTGAGGG - Intergenic
1041027013 8:53697222-53697244 CTGAAAACTGGCACAAGTCAGGG - Intergenic
1041751915 8:61270078-61270100 TTGAAAACTGGCACAAGAGAGGG - Intronic
1042597174 8:70462285-70462307 GTGAAAACTGGCACAAGACAGGG - Intergenic
1042772234 8:72392854-72392876 GAGAAAAATGGCAGGATTGAGGG - Intergenic
1043946695 8:86261675-86261697 GTAGAATATGGCAGCAGTGATGG - Intronic
1044252980 8:90025786-90025808 GTGAAAACTGGCACAAGACAGGG - Intronic
1045982031 8:108200924-108200946 GTAAAAAAGGGACCCAGTGAGGG + Intergenic
1046160786 8:110361716-110361738 TTAATAAATGGCACCTGTGATGG + Intergenic
1046601115 8:116317833-116317855 TTGAAAAATGGCACAAGACACGG + Intergenic
1046610149 8:116414387-116414409 TTGAAAAATGGCACAAGACAGGG + Intergenic
1048485913 8:134847560-134847582 CTGAAAAAAGGCACCACTCAAGG - Intergenic
1048715966 8:137270117-137270139 TTGAAAATTGGCACAAGTCAAGG + Intergenic
1048887683 8:138921627-138921649 GTGAAAGTTGGCTCAAGTGATGG + Intergenic
1049107119 8:140621125-140621147 ATCAGAAATGGCACCTGTGAGGG - Intronic
1049925952 9:407255-407277 GTGTAGAAAGGCACCAGGGATGG + Intronic
1050577208 9:7008991-7009013 GGGAAACATGACACCACTGAGGG + Intronic
1050661125 9:7883999-7884021 TTGAAAACTGGCACAAGTCAAGG + Intronic
1050861907 9:10445476-10445498 TTGAAAAATGGCAACAGAAATGG + Intronic
1051846555 9:21457675-21457697 GTGAAAACTGGCACAAGACAGGG + Intergenic
1051917180 9:22222403-22222425 TTGAAAACTGGCACGAGAGAGGG - Intergenic
1051940950 9:22504941-22504963 TTGAAAAATGGCACAAGACAGGG - Intergenic
1051945770 9:22568049-22568071 TTGAAAAATGGCACAAGACAGGG - Intergenic
1052037335 9:23697228-23697250 GTAAAGAATGGTACCAGTAAGGG + Intronic
1052078831 9:24178384-24178406 TTGAAAATTGGCACAAGAGAAGG - Intergenic
1052134455 9:24892791-24892813 TTGAAAACTGGCACAAGTCATGG + Intergenic
1052597869 9:30584614-30584636 TTGAAAAATGGCAAAAGAGAAGG + Intergenic
1053199868 9:36145020-36145042 TAGAAGAAAGGCACCAGTGAAGG + Intronic
1053435640 9:38072269-38072291 GGGCAAACTGGGACCAGTGAAGG + Intergenic
1053471714 9:38351240-38351262 TTGCAAAATGTCACCATTGAGGG + Intergenic
1055014367 9:71599903-71599925 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1055016093 9:71619673-71619695 CTGATAAATGGCCACAGTGAAGG - Intergenic
1055344529 9:75321301-75321323 GTGAAAAATGTCATTGGTGATGG + Intergenic
1055675134 9:78651187-78651209 GTGAAAACTGGCACAAGACAGGG - Intergenic
1055750156 9:79496616-79496638 GTGAAAACTGGCACAAGACAGGG - Intergenic
1055784066 9:79853380-79853402 GTGAAAACTGGCACAAGACAGGG + Intergenic
1056160031 9:83880161-83880183 GTGAATAAGGACAGCAGTGAAGG + Intronic
1056360192 9:85849657-85849679 GTGAATAAGGACAGCAGTGAAGG - Intergenic
1056957902 9:91097143-91097165 GGGGAAAAGGGCACCAGTGGGGG - Intergenic
1058513605 9:105746642-105746664 GTGAAAACTGGCACAAGACAGGG - Intronic
1058812668 9:108656436-108656458 ATCAAAAATGGCATCAGTTAGGG - Intergenic
1059058870 9:111014317-111014339 GAGAGAAATGGCAGCACTGATGG - Intronic
1059818937 9:117950299-117950321 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1062090758 9:134677626-134677648 TTGAAGAATGGCCCCAGGGACGG - Intronic
1203618058 Un_KI270749v1:87792-87814 GTGAAAACTGGCACAAGACAGGG + Intergenic
1185558778 X:1042632-1042654 GGGAGAACTGGCACCACTGAGGG + Intergenic
1187095275 X:16141458-16141480 GTGAAAAATGGCACCAGTGAAGG - Intronic
1189525209 X:41812667-41812689 GTGAAAACTGGCACAAGACAGGG + Intronic
1190683059 X:52845545-52845567 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1191066247 X:56351006-56351028 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1191203737 X:57812337-57812359 GTGAAAACTGGCACAAGACAGGG - Intergenic
1191876303 X:65800555-65800577 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1191927860 X:66334265-66334287 TTGAAAACTGGCACCAGACAGGG - Intergenic
1191950587 X:66587341-66587363 TTGAAAACTGGCACAAGAGAAGG - Intergenic
1192318402 X:70068628-70068650 GTGACAGATGGCACCAAAGATGG + Intergenic
1192376357 X:70566469-70566491 TTGAAAACTGGCACAAGAGAGGG - Intronic
1192398850 X:70813525-70813547 TTGAAAACTGGCACAAGAGAGGG + Intronic
1192703518 X:73502386-73502408 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1192714906 X:73628850-73628872 GAGAAAAATGGCACAATAGAAGG - Intronic
1192906496 X:75557225-75557247 TTGAAAATTGGCACAAGAGAGGG - Intergenic
1192907131 X:75563336-75563358 TTGAAAATTGGCACAAGAGAGGG - Intergenic
1192974763 X:76271347-76271369 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1193180353 X:78447651-78447673 GTGAAAACTGGCACTAGACAGGG - Intergenic
1193201408 X:78695750-78695772 GTGAAAACTGGCACAAGACAGGG + Intergenic
1193616451 X:83693966-83693988 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1193713164 X:84903217-84903239 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1193733513 X:85129711-85129733 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1194230922 X:91322646-91322668 GTGAAAACCGGCACAAGAGAAGG + Intergenic
1194963260 X:100259552-100259574 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1195278470 X:103307154-103307176 GTGAAGAATGGCCACAGTAAAGG + Intergenic
1195636061 X:107117535-107117557 GAGAACAATGGTACCAATGAAGG + Intronic
1195831926 X:109068701-109068723 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1196014936 X:110929132-110929154 GTGAGAAAGGGCATCTGTGAAGG - Intergenic
1197040077 X:121926393-121926415 TTGAAAACTGGCACAAGTCAAGG + Intergenic
1197237956 X:124089527-124089549 GTGAGAAATGGCAACAGGGATGG - Intronic
1197285153 X:124586614-124586636 TTGAAAACTGGCACAAGAGAGGG + Intronic
1197678394 X:129355879-129355901 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1198582172 X:138077472-138077494 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1198592768 X:138202348-138202370 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1198878270 X:141250891-141250913 GTGAAAACTGGCACAAGACAAGG - Intergenic
1198906421 X:141566939-141566961 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1199968157 X:152837360-152837382 TTGAAAACTGGCACAAGAGAGGG - Intronic
1199994874 X:153016672-153016694 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1200578157 Y:4915107-4915129 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1200805729 Y:7431739-7431761 TTGAAAACTGGCACAAGAGAGGG + Intergenic
1201248630 Y:12032672-12032694 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1201436948 Y:13969426-13969448 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1201536069 Y:15049750-15049772 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1201541314 Y:15108185-15108207 GTGAAAACTGGCACAAGACAAGG - Intergenic
1201586959 Y:15571713-15571735 TTGAAAACTGGCACAAGAGAGGG - Intergenic
1202094752 Y:21237584-21237606 TTGAAAAATGGCACAAGACAAGG - Intergenic
1202256269 Y:22923848-22923870 TTGAAAACTGGCACAAGTCAGGG + Intergenic
1202278313 Y:23148616-23148638 TTGAAAACTGGCACAAGAGAGGG + Intronic
1202286890 Y:23260151-23260173 TTGAAAACTGGCACAAGAGAGGG - Intronic
1202344775 Y:23909910-23909932 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1202374913 Y:24225945-24225967 GTGAAAACTGGCACAAGACAGGG + Intergenic
1202409259 Y:24557601-24557623 TTGAAAACTGGCACAAGTCAGGG + Intergenic
1202431137 Y:24779954-24779976 TTGAAAACTGGCACAAGAGAGGG + Intronic
1202438831 Y:24878208-24878230 TTGAAAACTGGCACAAGAGAGGG - Intronic
1202461522 Y:25112477-25112499 TTGAAAACTGGCACAAGTCAGGG - Intergenic
1202495867 Y:25444175-25444197 GTGAAAACTGGCACAAGACAGGG - Intergenic
1202525993 Y:25760173-25760195 TTGAAAACTGGCACAAGTCAGGG + Intergenic