ID: 1187095593

View in Genome Browser
Species Human (GRCh38)
Location X:16144419-16144441
Sequence CAATCCTAATGTATACTATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 118}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187095593_1187095595 30 Left 1187095593 X:16144419-16144441 CCACATAGTATACATTAGGATTG 0: 1
1: 0
2: 0
3: 15
4: 118
Right 1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187095593 Original CRISPR CAATCCTAATGTATACTATG TGG (reversed) Intronic
902897454 1:19488737-19488759 GAACCCTAATGTAAACTATTGGG - Intergenic
904847888 1:33434318-33434340 CATCTCTAGTGTATACTATGGGG - Intergenic
911360539 1:96870969-96870991 CAATAAAAATGTATACTCTGTGG + Intergenic
912225118 1:107724608-107724630 CAATCCTACAGTATAGGATGGGG + Intronic
915641302 1:157229135-157229157 CAATTATTATGTATACTATCTGG - Intergenic
915659708 1:157392461-157392483 CAATTATCATGTATACTATCTGG - Intergenic
915668188 1:157463799-157463821 CAATTATGATGTATACTATCTGG + Intergenic
916092258 1:161316598-161316620 GAATCCTAGTGTGGACTATGGGG - Intronic
917800731 1:178567642-178567664 CACTCCTAATTCATTCTATGAGG - Intergenic
919461970 1:197888397-197888419 TGATCCTAATGTATAATATATGG - Intergenic
921412990 1:214856307-214856329 CAATCCTAATTTATTCAAAGTGG + Intergenic
921481031 1:215664942-215664964 CAGGCCTAATTTATATTATGAGG + Intronic
921977065 1:221214518-221214540 CAATCATAAAGTATGCTAGGAGG - Intergenic
1063821304 10:9839508-9839530 CAACCCTCATGAATACTTTGAGG + Intergenic
1068625813 10:59245246-59245268 CAATACTAACTTATACTTTGGGG + Exonic
1068821739 10:61384807-61384829 GAATCCTAACCTATACTATGTGG - Intergenic
1072073612 10:91945971-91945993 CCATCCTAATGGATATGATGTGG + Intronic
1073905937 10:108279510-108279532 CAACCCAAATGTTTACCATGAGG + Intergenic
1076610169 10:131720852-131720874 CAGTCATGATGTATACTTTGTGG + Intergenic
1077896888 11:6459658-6459680 CAATAGTAATGTAGACTATGAGG + Intronic
1082065642 11:47897734-47897756 CAATCCTAATTCATTCTATGAGG + Intergenic
1082115096 11:48319700-48319722 CAATTCTATTGTATAACATGTGG + Intergenic
1085585162 11:77695966-77695988 CAATCCTAACCTGTACCATGGGG + Intronic
1086014650 11:82152588-82152610 CAATCCAAATGTCCACTAAGAGG - Intergenic
1087365640 11:97215211-97215233 GAGCCCTAATGTAAACTATGGGG + Intergenic
1087370497 11:97277959-97277981 TATTCCTAATATATTCTATGAGG + Intergenic
1087475472 11:98628289-98628311 CATTACTAATGTACACTATGTGG + Intergenic
1087797146 11:102466672-102466694 CAGCCCTAATGCATACTAGGAGG - Intronic
1088420906 11:109645626-109645648 CATTCCTATTGTACAATATGAGG - Intergenic
1090583343 11:128183826-128183848 CCATCCTAATGTCTGCTATTGGG - Intergenic
1093833655 12:23798900-23798922 CAACCCTATTGTATACAATGAGG + Intronic
1093869716 12:24274442-24274464 CCATGCAAATGGATACTATGTGG - Intergenic
1095688440 12:45061699-45061721 CAATCCTGCTTTATTCTATGTGG - Intergenic
1095820385 12:46472041-46472063 CAATCCAAATAAATACCATGTGG - Intergenic
1098370206 12:69750790-69750812 CAAACATTATGTATATTATGTGG - Intronic
1102541794 12:113625480-113625502 CAATGCTAATGTATAATACTTGG + Intergenic
1103820958 12:123698385-123698407 CCATCCTAATAGATACTAAGTGG + Intronic
1105639863 13:22251495-22251517 CACTCCTAATGTTTTCTTTGAGG + Intergenic
1108527891 13:51301265-51301287 GAATCCTAATGTAAACACTGTGG - Intergenic
1108898664 13:55368073-55368095 AAATGCTACTGTATAATATGAGG - Intergenic
1109455610 13:62584926-62584948 CACTCCTATTGTATAATTTGAGG - Intergenic
1111670723 13:91326382-91326404 TAATTCTAGTGTATACTCTGTGG + Intergenic
1112199785 13:97263279-97263301 CAATTCTAATGTATCCTAGGTGG + Intronic
1117544222 14:56778943-56778965 TAATCCTATTATATACCATGTGG + Intergenic
1120476536 14:84995902-84995924 CAAACCCTATGTATACTATGTGG + Intergenic
1120523414 14:85550236-85550258 CATTCGTAATATATTCTATGGGG + Intronic
1129805959 15:78458266-78458288 GAACCCTAATGTAAACTGTGGGG + Intronic
1132918213 16:2366546-2366568 CAATCCTACTGTAGCCTATGAGG + Intergenic
1139075463 16:63441745-63441767 CAAATCTAATCTATATTATGGGG - Intergenic
1144246088 17:13366398-13366420 AAATCTTAATGTTTACTTTGTGG - Intergenic
1147476456 17:40716143-40716165 CAATCCTAGTGAATATTAAGTGG - Intergenic
1150243734 17:63657661-63657683 CAATCTCACTGGATACTATGGGG - Intronic
1150585704 17:66516047-66516069 CAATCCTAATATCTACTATCAGG - Intronic
1150832736 17:68538805-68538827 AAATCCTAATTCATCCTATGTGG + Intronic
925015490 2:521250-521272 ATATCCTAATGTATCCCATGAGG - Intergenic
928199791 2:29240306-29240328 TATTCCTCATCTATACTATGGGG + Intronic
930747995 2:54904421-54904443 CAAGCCCAATGTATGCTCTGAGG + Intronic
935445172 2:103148765-103148787 TAATTCAAATGTATACTCTGTGG - Intergenic
937710381 2:124974290-124974312 CAAACCTAATGATTACTTTGAGG - Intergenic
938255400 2:129855545-129855567 ACTTCCTAATGTATTCTATGAGG + Intergenic
938725818 2:134108207-134108229 CAAACCTAGTGGATACTATTTGG - Intergenic
940662890 2:156569490-156569512 CAAGCCTAATGTAGAGTGTGGGG - Exonic
942337991 2:174911725-174911747 GGATCCTAATGAATGCTATGAGG - Intronic
942782742 2:179665182-179665204 CAATGCTAATGTATAGTAAGTGG + Intronic
944423852 2:199558549-199558571 CAATCATAATGTATATAGTGTGG + Intergenic
1173322712 20:42002823-42002845 AAATCCTACTATACACTATGAGG - Intergenic
1177108416 21:16991731-16991753 CAATTCTAATGTATTTTCTGAGG + Intergenic
1177390958 21:20471408-20471430 CAATACTAATGTATAATTTTGGG - Intergenic
949140149 3:622885-622907 AAATCCTAATGCATGCTAGGAGG - Intergenic
952446103 3:33382424-33382446 CAAAACTAATATATACTATTTGG - Intronic
954831856 3:53427730-53427752 TAATATTCATGTATACTATGGGG - Intergenic
956090610 3:65662772-65662794 GAAATCTAATGTATAGTATGAGG - Intronic
956917090 3:73883122-73883144 CCATCCTAATCTATACTTGGTGG + Intergenic
958994095 3:100881616-100881638 AAAACCTAATGTTTACTATTAGG - Intronic
959676996 3:109047176-109047198 GAAACCTAATGTACAATATGAGG - Intronic
959756676 3:109907782-109907804 CATTCCTAATTCATTCTATGGGG - Intergenic
960910775 3:122647298-122647320 CAACCCCAAAGTATACCATGGGG + Intergenic
967001517 3:185340272-185340294 AAAACCTGATGTAAACTATGGGG + Intronic
977261185 4:94799108-94799130 CATTCCAGAAGTATACTATGAGG - Intronic
978129539 4:105178545-105178567 GAACCCTAATGTAAACTATGGGG + Intronic
979671382 4:123363514-123363536 CAAGCATAATGTTTACAATGGGG - Intergenic
980505121 4:133709220-133709242 GATTCCTAATTTATTCTATGAGG - Intergenic
981062453 4:140439676-140439698 CAATCCAAATGTCTATTAAGAGG - Intergenic
983540210 4:168901192-168901214 CAATCCTAATGTAATTTATATGG - Intronic
983752097 4:171286855-171286877 CAATGCTAATATATACTAAAGGG - Intergenic
983927464 4:173417323-173417345 CATTCCTAATCTATAAAATGAGG - Intergenic
986520255 5:8608244-8608266 GATTTCTAATGTATACCATGGGG + Intergenic
986829744 5:11562895-11562917 CAGTCCTAATGAAAACTATACGG + Intronic
987648332 5:20706086-20706108 AAATCCAAATGAATACTAAGGGG + Intergenic
988747995 5:34162827-34162849 AAATCCAAATGAATACTAAGGGG - Intergenic
990965135 5:61438044-61438066 CAATTATAATTTATATTATGAGG + Intronic
994794112 5:104271735-104271757 GGATACTAATGTATACTAAGTGG - Intergenic
1000011784 5:157240110-157240132 CAATCCTAAGCGATACTATGTGG + Exonic
1005545580 6:26865914-26865936 AAATCCAAATGAATACTAAGGGG - Intergenic
1005588566 6:27301077-27301099 CAATTCTAATGTATCCCCTGAGG + Intronic
1006957520 6:37887443-37887465 TAACCTTAATGTATATTATGAGG + Intronic
1009016283 6:57906680-57906702 AAATCCAAATGAATACTAAGGGG - Intergenic
1010704255 6:79089187-79089209 CAAGCCTTATGTATTCTTTGAGG - Intergenic
1011026440 6:82874488-82874510 CAAACTTAATGAATACTATTTGG - Intergenic
1016316204 6:142790575-142790597 CAATGCTTATGTTTACTATTCGG + Intronic
1023481193 7:40636442-40636464 CATTCCTAATGAATAGAATGAGG - Intronic
1024030022 7:45453029-45453051 TAATTCTATTGTATACCATGAGG - Intergenic
1024806678 7:53149587-53149609 GAACTCTAATGTAGACTATGGGG + Intergenic
1027535069 7:79389725-79389747 GAATCCTAGTGTATATAATGGGG + Intronic
1029196008 7:98805948-98805970 CAATACTCATGTTTACTATCTGG + Intergenic
1031159366 7:118147718-118147740 CAATCCTAATATATCCCATCTGG + Intergenic
1031524448 7:122807488-122807510 CAATCATAATGTCTACAATGAGG + Intronic
1031558712 7:123210500-123210522 CAGTCCTGATGCACACTATGTGG - Intergenic
1035123950 7:156594204-156594226 CAATCCTCATGAAATCTATGAGG + Intergenic
1036667988 8:10760206-10760228 CATTTCTAATGCATTCTATGTGG + Intronic
1042408490 8:68434253-68434275 AATACCTAATGTATGCTATGCGG - Intronic
1043489789 8:80737558-80737580 CACTTCTAATGAATACAATGTGG - Intronic
1044258113 8:90090013-90090035 CAATCCAAATGTCTACTAACTGG - Intronic
1044354271 8:91202711-91202733 AATTCCTAATGTAAACTACGTGG - Intronic
1046284880 8:112082124-112082146 CAATTCAAATATCTACTATGTGG - Intergenic
1050326141 9:4499674-4499696 CAATCTTAATGCCTCCTATGAGG + Intronic
1051840114 9:21386612-21386634 CTTTCCAAATGTATTCTATGAGG - Intergenic
1055807206 9:80109427-80109449 GAATCCTAATTTATAAAATGTGG - Intergenic
1058537360 9:105975978-105976000 AAATCACAATGTAGACTATGTGG - Intergenic
1058950325 9:109897220-109897242 TAATCATAAGGTATACTTTGGGG + Intronic
1059867129 9:118528022-118528044 CAACCCTAAAGCATACTTTGAGG + Intergenic
1187095593 X:16144419-16144441 CAATCCTAATGTATACTATGTGG - Intronic
1187676614 X:21722647-21722669 CAATCCTAATGTAAAGGATGAGG - Intronic
1188765535 X:34087162-34087184 CAATCATAATTCATACTCTGTGG - Intergenic
1191041206 X:56081960-56081982 AAATCCTGATTTATCCTATGAGG - Intergenic
1194101051 X:89704398-89704420 AGATACTAATGTATACTATTAGG - Intergenic
1194849637 X:98855362-98855384 CAGTCCTGATGTTTCCTATGGGG + Intergenic
1194904131 X:99552664-99552686 CAATCCAAATGTATATTAGCAGG - Intergenic
1195007945 X:100705302-100705324 GAATCCTAATCTATACAATGGGG - Intronic
1195328698 X:103779013-103779035 CAATCCTAAGGGATTCTATATGG - Intronic
1195974765 X:110514572-110514594 AAAACCTAATGAAAACTATGTGG + Intergenic
1200454005 Y:3365482-3365504 AGATACTAATGTATACTATTAGG - Intergenic
1201492373 Y:14556420-14556442 TAATACTAATGGTTACTATGGGG - Intronic
1201500329 Y:14635204-14635226 TAATCCCAATGTATACTCTTTGG + Intronic