ID: 1187095595

View in Genome Browser
Species Human (GRCh38)
Location X:16144472-16144494
Sequence CAATTCCTACAGACTTCCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187095593_1187095595 30 Left 1187095593 X:16144419-16144441 CCACATAGTATACATTAGGATTG 0: 1
1: 0
2: 0
3: 15
4: 118
Right 1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187095595 Original CRISPR CAATTCCTACAGACTTCCGT AGG Intronic
903172780 1:21564036-21564058 CAATGCCCACAGATTTCCCTGGG - Exonic
905250084 1:36642862-36642884 CTGTTCCCACAGACTTCAGTGGG + Intergenic
905522533 1:38611570-38611592 CATATTCTACAGACTTCCCTGGG + Intergenic
907673727 1:56499562-56499584 CAACTCCTACAGACTTGAGGGGG + Intronic
908850962 1:68375267-68375289 CAGCTCCCACAGACTTCCTTCGG + Intergenic
914511242 1:148334242-148334264 GAAATCCTACAAACTTCTGTGGG + Intergenic
918598472 1:186322550-186322572 CACGTCCTACAGACTGCCTTCGG + Exonic
1063938904 10:11107464-11107486 CCATTCCTCCAGTCTTCTGTAGG - Intronic
1080851727 11:36076311-36076333 CAATTCCTTCAAATTTCCATTGG + Intronic
1084051776 11:66604889-66604911 CAATTCCTATAGGCTTAAGTTGG - Intronic
1086749782 11:90477473-90477495 CAACTCCTACAGAATTGCATGGG - Intergenic
1088642748 11:111889211-111889233 CAATTCCTTCAGTCTTCTGATGG + Intergenic
1091704783 12:2686337-2686359 CAAATCCTGAAGACTTCAGTGGG + Intronic
1093894357 12:24561003-24561025 CAAATCCCACAGATTTCCCTTGG + Intergenic
1097266033 12:57745348-57745370 GAATTCCTGGGGACTTCCGTGGG + Intronic
1098033274 12:66276563-66276585 CAATTCTTTCAGACTTTCCTTGG + Intergenic
1116743791 14:48792381-48792403 CAGTCCCTACTGACTTCCCTTGG - Intergenic
1117549519 14:56819770-56819792 CAACTCCTACAGTTTTCCCTAGG - Intergenic
1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG + Intergenic
1128866257 15:71116922-71116944 CAATTCCTATAGATTTTTGTTGG + Intronic
1131874051 15:96785972-96785994 CAATTCCTAGAGTCTTACCTAGG - Intergenic
1132082276 15:98876574-98876596 CCATTCCCACAGAATTCTGTTGG - Intronic
1137585295 16:49660634-49660656 CAATTACTCCAGTCTTCAGTGGG + Intronic
1140801227 16:78490257-78490279 CACTTCCAAAAGGCTTCCGTTGG - Intronic
1151438093 17:74110738-74110760 CACTTCCCACACACTTGCGTGGG - Intergenic
1155611209 18:27669554-27669576 CACTTCCTGCAGCCTACCGTGGG + Intergenic
1158616599 18:58993460-58993482 TCATTCATACAGACTTCCCTTGG + Intergenic
1159292204 18:66437860-66437882 CAATCCCAACAGTCTTCAGTGGG - Intergenic
929202957 2:39257456-39257478 CATTTCCTCCAGACTCCTGTAGG - Intronic
933345764 2:81083759-81083781 CATTTCCTATATACTTCCCTGGG + Intergenic
935165651 2:100566561-100566583 CAATTCTTTCAGACTTTCCTTGG - Exonic
937680219 2:124635539-124635561 CAAGTCCTCCTGACTTCCCTGGG + Intronic
940665021 2:156598600-156598622 CATTTCCTACAGAGTTCTATGGG + Intronic
942469252 2:176242670-176242692 CATTTCCCACAAACATCCGTGGG + Intergenic
1170270426 20:14521492-14521514 AAATGCTTACAGTCTTCCGTAGG - Intronic
1172795922 20:37537518-37537540 CATTTCCTACACACTTTTGTGGG - Intergenic
950981891 3:17315877-17315899 CCATGCCTACAGCCTTCAGTGGG - Intronic
951030679 3:17878084-17878106 CAATTCTTTCAGACTTTCCTTGG + Intronic
951367249 3:21798426-21798448 CAACTCCTAGAGACATCCTTGGG + Intronic
959072145 3:101712537-101712559 CAATTCTTTCAGACTTTCCTTGG - Intergenic
961570308 3:127793044-127793066 GAATTCCTTCAGACTTAGGTAGG - Intronic
961619267 3:128210687-128210709 CAATTCCTACGGATTTCCCCTGG + Intronic
982907391 4:161092085-161092107 AAATTCCTATAAACTTCAGTGGG - Intergenic
987706758 5:21468883-21468905 CAATTCCTCCAGACCTCGGGGGG - Intergenic
987905685 5:24073119-24073141 CACATCCTACAGTCATCCGTGGG - Intronic
991414104 5:66374323-66374345 CAATTTCTACAGAATTCTGATGG - Intergenic
996232112 5:121078451-121078473 CCATTCCCACAGACTTCTGAAGG + Intergenic
1002015035 5:176314384-176314406 CAAGACCAACAGACTTCCTTTGG + Intronic
1003747056 6:9014142-9014164 AATTGCCTACAGACTTCTGTGGG + Intergenic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1020979485 7:15050366-15050388 CAATTTTTACAGAATTCCATAGG - Intergenic
1023086916 7:36579929-36579951 CAATTCCTTCAGACTTGTGAGGG - Intronic
1023610092 7:41964284-41964306 CAACTCCTATTGATTTCCGTTGG + Exonic
1031012474 7:116538135-116538157 CAATTTCTACAGACATTTGTGGG + Intronic
1031990634 7:128196654-128196676 CAAGTCCTTCAGACTACAGTTGG - Intergenic
1032072545 7:128817550-128817572 CAATTCCTGCAGACTGCCGGTGG + Intronic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1037045639 8:14299444-14299466 CAATTCCTACAAATTACAGTAGG + Intronic
1041659473 8:60387284-60387306 CAATTCTTTCAGACTTTCCTTGG + Intergenic
1041659483 8:60387343-60387365 CAATTCTTTCAGACTTTCCTTGG - Intergenic
1044004083 8:86920613-86920635 CATTCCCAACAGACTTCCTTGGG - Intronic
1045745887 8:105421515-105421537 CAGTTCCAACTGACTTCAGTGGG - Intronic
1047162516 8:122396530-122396552 CAATTCCTGCTGACCTCCCTTGG - Intergenic
1048917702 8:139200538-139200560 CAATTCCTCCAGCCTTGCCTAGG + Intergenic
1051182402 9:14425046-14425068 CAATTCCTACAGAAGGCCTTGGG + Intergenic
1053567840 9:39271588-39271610 CAATTCCTACAGTCTACCTGTGG + Intronic
1054129303 9:61347411-61347433 CAATTCCTACAGTCTACCTGTGG - Intergenic
1054596705 9:67074875-67074897 CAATTCCTACAGTCTACCTGTGG - Intergenic
1059047272 9:110882539-110882561 CAATTCCTACACACTTTTGAAGG + Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1197333981 X:125188976-125188998 CAATTTCTACAGACTTGCTCTGG - Intergenic
1200807585 Y:7448130-7448152 CAATCCCTACAGAATTCCTTGGG + Intergenic