ID: 1187096152

View in Genome Browser
Species Human (GRCh38)
Location X:16150639-16150661
Sequence ATACATGTCAAGAAGCAGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 190}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187096150_1187096152 -9 Left 1187096150 X:16150625-16150647 CCGTGGAAGGGAATATACATGTC 0: 1
1: 0
2: 0
3: 14
4: 145
Right 1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 190
1187096145_1187096152 11 Left 1187096145 X:16150605-16150627 CCAGAGTGCTTACAATCTTCCCG 0: 1
1: 0
2: 0
3: 6
4: 83
Right 1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 190
1187096149_1187096152 -8 Left 1187096149 X:16150624-16150646 CCCGTGGAAGGGAATATACATGT 0: 1
1: 0
2: 2
3: 15
4: 190
Right 1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG 0: 1
1: 0
2: 0
3: 11
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187096152 Original CRISPR ATACATGTCAAGAAGCAGGT AGG Exonic
901668058 1:10837648-10837670 ATAGATGTCAAGAAGCCTGTGGG + Intergenic
902121921 1:14173621-14173643 ATAAATGTGAAGCAGCTGGTGGG + Intergenic
906588339 1:47000714-47000736 AGACAGGTAGAGAAGCAGGTAGG + Intergenic
907975139 1:59424250-59424272 ATACATGTGAAGAATGAGGCCGG + Intronic
908186669 1:61658965-61658987 AAAGATTTCAAGAAGCAGGTGGG - Intergenic
909483128 1:76146909-76146931 AGAGATGTCAAGGAGGAGGTCGG - Intronic
909824142 1:80104891-80104913 AGACATGTCAAAAAGCAGAGAGG - Intergenic
911260146 1:95676513-95676535 CTACATTTTGAGAAGCAGGTAGG + Intergenic
912905143 1:113697597-113697619 GTGCATGTGAACAAGCAGGTGGG + Exonic
913692225 1:121290002-121290024 AAAGTTGTCATGAAGCAGGTGGG + Intronic
914145330 1:144990112-144990134 AAAGTTGTCATGAAGCAGGTGGG - Intronic
915211789 1:154314956-154314978 ATACAAGACAAGAAGGAGGCCGG - Intergenic
916368668 1:164062910-164062932 ATACCTGGCAAGAAATAGGTAGG + Intergenic
918554970 1:185787878-185787900 ATAAAGGTCAAAAATCAGGTAGG + Intronic
919126576 1:193401553-193401575 ATACATGTCAAGGTTCAGCTAGG - Intergenic
920479549 1:206308351-206308373 AAAGTTGTCATGAAGCAGGTGGG + Intronic
922076014 1:222245416-222245438 ATACATGTTAAGATGTACGTTGG + Intergenic
923184391 1:231556692-231556714 ATACATGGCAATAGGTAGGTAGG - Intronic
924472185 1:244352235-244352257 ATACCTGCAAAGGAGCAGGTTGG + Intergenic
1063770434 10:9192426-9192448 ATACATTTCAAAATGTAGGTAGG + Intergenic
1065503259 10:26402391-26402413 ATCAATGTTAAGAAGCAAGTGGG + Intergenic
1066215426 10:33281758-33281780 ATACATGTCATGACGCTTGTAGG + Intronic
1067107944 10:43377982-43378004 ATACATGTGAAGGTGGAGGTGGG - Intergenic
1067265698 10:44742443-44742465 ATACCTGTCAGGACGCAGGTGGG + Intergenic
1067826315 10:49576105-49576127 AGATGTGTCAAGAAGCAGGGAGG + Intergenic
1068542851 10:58314738-58314760 ATACAAGAAAAGAAGCCGGTAGG - Intergenic
1069506654 10:69004415-69004437 ATATATGTCTAAAAGCAGATTGG + Intronic
1070661492 10:78309644-78309666 AAACATCTCAAGAAGGAGGTAGG + Intergenic
1071577422 10:86739472-86739494 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1073584799 10:104699482-104699504 ATACTTGTCAAGAGCCAGTTGGG - Intronic
1077038952 11:509234-509256 ATTCATGACAAGAAGCTGGAAGG + Intergenic
1077257051 11:1590382-1590404 GGACATGGCATGAAGCAGGTGGG - Intergenic
1083995371 11:66269015-66269037 ACAGTTGTCAAGCAGCAGGTGGG - Intronic
1087589771 11:100172743-100172765 ATAGATGTAAAAAAGCAGCTGGG + Intronic
1089081755 11:115782000-115782022 CCACATGTGAAAAAGCAGGTAGG - Intergenic
1089319159 11:117613311-117613333 AGACATGGTAGGAAGCAGGTGGG + Intronic
1096606707 12:52771866-52771888 GAAAATGTCAAGAAGCAGGTGGG - Exonic
1098100500 12:67011087-67011109 ACAAATGTCAAGAAGACGGTTGG - Intergenic
1098709029 12:73731014-73731036 ATACATGTTAAGAATGATGTAGG + Intergenic
1099149062 12:79085860-79085882 AGACATTTCAAGAAGCACTTTGG + Intronic
1099596295 12:84670981-84671003 ACACATGTCTAGAAGCAGAGGGG + Intergenic
1099799706 12:87442120-87442142 ATACAGGTAGAGGAGCAGGTAGG - Intergenic
1099902840 12:88734115-88734137 ATACCTGTCATAAAGTAGGTAGG + Intergenic
1103122255 12:118390168-118390190 ATAGAAGTCAATAAGCAGTTAGG - Intronic
1106670780 13:31902925-31902947 ATACATGTAAAGAAGAACGTGGG + Intergenic
1106867130 13:33977562-33977584 ACACATTTTAAGAAGCATGTTGG - Intergenic
1107795015 13:44042617-44042639 AGACATGTTCACAAGCAGGTCGG + Intergenic
1107892396 13:44925714-44925736 AGAAATGTCAAAAAGAAGGTAGG + Intergenic
1108135006 13:47346585-47346607 ATACATGTTAAGTAGCAGTAAGG + Intergenic
1108209278 13:48122041-48122063 AGACATGTAAAGAAGCTGCTAGG - Intergenic
1109037065 13:57277408-57277430 CTACATGTCAAGAAACATCTTGG + Intergenic
1109342496 13:61078963-61078985 ATACATATCCAGAAGCACTTAGG + Intergenic
1110022506 13:70492585-70492607 ATAGATATCAAGAAGCGGGGAGG - Intergenic
1112234762 13:97625326-97625348 GTACATGGCAAGAAGGAGGAGGG - Intergenic
1114205591 14:20568677-20568699 TTACAGGTCTAGAAGCAGATAGG - Intergenic
1115468421 14:33741809-33741831 AGAGATTTCAGGAAGCAGGTAGG + Intronic
1116190797 14:41662911-41662933 ATAAATGTAAAGAAGGTGGTTGG - Intronic
1126155728 15:45564103-45564125 CCCCATGTCAGGAAGCAGGTTGG - Intergenic
1129626682 15:77207946-77207968 ATACAGGTCTAGGAACAGGTTGG + Intronic
1132237401 15:100232505-100232527 TTTCATGTTAAGAAGAAGGTGGG - Intronic
1134270080 16:12725392-12725414 ACACTTGTCAAGAATCATGTTGG - Intronic
1135398932 16:22152325-22152347 ATAGCTGTCCAGAAGCTGGTGGG + Intronic
1137977360 16:53042677-53042699 ATACTTCTCAATAGGCAGGTAGG + Intergenic
1142405085 16:89884110-89884132 ATACATGTGAAGTGACAGGTGGG + Intronic
1144004628 17:11088873-11088895 CTACATTTCAAGCATCAGGTGGG + Intergenic
1146065134 17:29628815-29628837 ATCCCTGCCAGGAAGCAGGTTGG - Exonic
1146473404 17:33142402-33142424 ATAAATGTTCAGAAGCAGCTGGG - Intronic
1148647561 17:49227918-49227940 AGACAGGTCAAGGAGGAGGTGGG + Intronic
1149693420 17:58597571-58597593 AGAGATGTCAAGATGCGGGTGGG - Intronic
1150463391 17:65371522-65371544 ATACAGGTGAAATAGCAGGTGGG - Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1156484190 18:37454466-37454488 ATGCATGACAAGAACCATGTGGG - Intronic
1156828368 18:41461401-41461423 ACACATGGAAAGCAGCAGGTGGG + Intergenic
1156894009 18:42223442-42223464 AAAGATGTGAAGAAGCAGTTAGG + Intergenic
1157925664 18:51763356-51763378 ATACTTGGGAAGAAACAGGTAGG - Intergenic
1159435534 18:68412082-68412104 ATATTTGTCAAAAATCAGGTGGG - Intergenic
1159685400 18:71412837-71412859 ATACATGAATAGAAGCAGGGAGG - Intergenic
1159881039 18:73858791-73858813 ACACATTTCATGAGGCAGGTGGG + Intergenic
1164452378 19:28377939-28377961 ATACATCTCAATAAGTTGGTTGG + Intergenic
1167900149 19:52615434-52615456 AGACACAGCAAGAAGCAGGTTGG + Intronic
926349585 2:11983015-11983037 ATACATGTGAAGAAGCACCCAGG + Intergenic
927304369 2:21553824-21553846 ATGCATGTAAAGAAGCATGCAGG - Intergenic
928424299 2:31165461-31165483 ATACATCCCAAGAAGCAAATGGG - Intergenic
928710790 2:34003116-34003138 GTAGATGGCAAGAAGCAGGCAGG - Intergenic
929773220 2:44910448-44910470 AGAAATGTTAAGAAGCATGTAGG + Intergenic
932260214 2:70320757-70320779 ACACTTGTCAAGAAGCAGGAAGG - Intergenic
933143708 2:78825052-78825074 AGACATGTTAAGAATCAGTTAGG + Intergenic
933464664 2:82637146-82637168 GTATATGCCAAGAAACAGGTTGG + Intergenic
935081851 2:99806296-99806318 CTACATGTGAAGCAGCATGTGGG + Intronic
938663975 2:133515038-133515060 TTACTAGGCAAGAAGCAGGTAGG - Intronic
938892824 2:135722737-135722759 ATATATGGTAAGATGCAGGTAGG + Intronic
939639998 2:144628691-144628713 ATACAGGACAAGAAGCATGCAGG + Intergenic
940667189 2:156623118-156623140 AAACATGACAAAAAGCAAGTGGG + Intergenic
941094860 2:161227504-161227526 TTACATGTGAAGAAACTGGTTGG - Intronic
941388382 2:164881188-164881210 ATAAATTTCAAGAAGAAGGAAGG - Intergenic
941529349 2:166646902-166646924 ACACATGTAAAGAAACAGGAAGG - Intergenic
942209551 2:173656953-173656975 AAAAATATCAAGAAACAGGTGGG - Intergenic
943063827 2:183066590-183066612 ATAGATTTCTAGAAGAAGGTAGG + Intergenic
943187152 2:184625118-184625140 GAAAATGTCAAGAATCAGGTTGG + Intronic
943347577 2:186757713-186757735 ATGCATGTCTAGAAGGAGTTAGG - Intronic
943585643 2:189736115-189736137 ATACAGGACAAGAACCAAGTTGG - Intronic
944365010 2:198908123-198908145 ATAAGTGTGGAGAAGCAGGTGGG + Intergenic
946180281 2:217944897-217944919 ATAAAAGTGAAGAAGCAGATAGG + Intronic
946540730 2:220681715-220681737 ACACATTTCAAGAACCAGGGTGG + Intergenic
948641949 2:239380764-239380786 ATCCATGTGAACAAGCAGTTTGG - Intronic
948987873 2:241536405-241536427 ACACATGTCAGCCAGCAGGTGGG + Intergenic
1171565212 20:26177920-26177942 ATACAAGTTAAGATGCACGTTGG + Intergenic
1173073501 20:39793379-39793401 AAACATGTAAAGCAGCATGTTGG - Intergenic
1174080302 20:47966650-47966672 TTAGATGTAAAGAACCAGGTTGG + Intergenic
1174137288 20:48388568-48388590 TTAGATGTAAAGAACCAGGTTGG - Intergenic
1176139705 20:63539603-63539625 AAACACGTCAAGAAGCAAGGGGG - Intergenic
1178505543 21:33159814-33159836 ACACATTGCAAGCAGCAGGTGGG + Intergenic
1181159599 22:20950730-20950752 AAACAGGTTAAGTAGCAGGTTGG + Exonic
949656844 3:6230746-6230768 ATGAATGTCAAAAAGCGGGTAGG - Intergenic
951059710 3:18190876-18190898 ATCTATGTCAAGAAGTGGGTAGG + Intronic
952946624 3:38482262-38482284 ATACATGTCAATGCGCAGGAAGG - Exonic
956091111 3:65667891-65667913 ACACATGTCCAGCTGCAGGTGGG - Intronic
956567284 3:70652980-70653002 AAACATGTTAAGAAGCTGGAAGG + Intergenic
957994315 3:87669485-87669507 ATAAATGTTAAGAAGAAGGAAGG - Intergenic
959969745 3:112396291-112396313 ATGCATGTCAAGAAGTAGAAGGG - Intergenic
962535321 3:136324240-136324262 ATACAAGTTAAGAAACAGGCTGG - Intronic
964450991 3:156813180-156813202 ATACATGCCAAAGGGCAGGTAGG + Intergenic
964744993 3:160003838-160003860 ATGCATGTCAAGATCCAGGCAGG - Intergenic
965682953 3:171270676-171270698 ATACCTGTCAGGAAACAGCTGGG - Intronic
968526944 4:1064223-1064245 ATACATATGACAAAGCAGGTGGG + Intronic
968933376 4:3596327-3596349 AAAGATGTCAACAGGCAGGTCGG - Intergenic
970211351 4:13713364-13713386 ACACATGTGAAGATGCAGGCAGG + Intergenic
971055212 4:22905452-22905474 ATACAGGTGAAGAAACATGTTGG + Intergenic
974186718 4:58456718-58456740 TTACATGTGAATAAGCAGGAGGG - Intergenic
976143237 4:82015124-82015146 ATACATATAAAGAAGCAAGAAGG + Intronic
977001141 4:91504868-91504890 ATAAATGTCAAAAATCAGATGGG - Intronic
977939757 4:102845624-102845646 ATATATGTCAAGCAGCACCTTGG + Intronic
977974234 4:103245465-103245487 ATACATGTTAATTATCAGGTGGG - Intergenic
979372106 4:119901327-119901349 ATGCATGTTTAGATGCAGGTAGG - Intergenic
979696009 4:123614033-123614055 AGACTTCTCAAGAAGTAGGTTGG + Intergenic
983244639 4:165274200-165274222 ATACATGTAAAGCAGAAGGGAGG + Intronic
987306404 5:16641667-16641689 AAACATGGCAAGAATCTGGTAGG - Intergenic
988248798 5:28726699-28726721 CTACATTTGAAGAAGCAGGAAGG - Intergenic
990378143 5:55193736-55193758 ATTCATGTGCAGAAACAGGTGGG - Intergenic
990644307 5:57826489-57826511 AAAAATGGCAAGAAGCAGCTGGG - Intergenic
990677816 5:58207980-58208002 ATCCCTGTCAAGCATCAGGTAGG - Intergenic
990854629 5:60250331-60250353 ATACATCTCTAGAGGCAGCTAGG + Intronic
991434924 5:66588012-66588034 ATGCATATGAGGAAGCAGGTGGG + Intergenic
992097483 5:73376464-73376486 AGACATGTCAAGAGGCAGTATGG - Intergenic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993131215 5:83900529-83900551 CTCCTTGTCAAGAAGCAGATAGG + Intergenic
994594772 5:101818557-101818579 TTACATGTCATGAAGCTTGTTGG - Intergenic
998455244 5:142267222-142267244 AAACATTTAAAGAAGCATGTTGG - Intergenic
999932749 5:156451335-156451357 ATAGATTTCAACAAGCAGGAAGG + Intronic
1000513017 5:162207106-162207128 ATGCATGTGAGGATGCAGGTTGG + Intergenic
1000520848 5:162293122-162293144 ATAAATGTCAGGTAGGAGGTGGG + Intergenic
1003183064 6:3808305-3808327 AAACATGTCCAGTAGCAAGTGGG + Intergenic
1004226933 6:13794082-13794104 ACACATATAAAGAAGCAGGTAGG - Intronic
1004773673 6:18817125-18817147 ATACATGTCATGTGGCATGTTGG - Intergenic
1006234804 6:32619955-32619977 ATACATAGAAAGAAACAGGTTGG + Intergenic
1008382397 6:50849885-50849907 ATACATGTAAATAAACAGCTTGG - Intergenic
1008550172 6:52621264-52621286 ATACATTTTAAAAAGTAGGTTGG + Intergenic
1011272466 6:85593575-85593597 TTACCTGTTAAGAAGCAGGGAGG + Exonic
1012328458 6:97954352-97954374 ATAGATGTCAAGTAATAGGTTGG + Intergenic
1014656697 6:124114468-124114490 AGAGATGTCAAGTAGGAGGTTGG + Intronic
1015680517 6:135802604-135802626 ATCCATCTCAGGTAGCAGGTTGG + Intergenic
1017722666 6:157254898-157254920 ATAGATGTTAGGAGGCAGGTAGG - Intergenic
1022131780 7:27411393-27411415 CTACCTGACAAGTAGCAGGTTGG - Intergenic
1024362475 7:48482768-48482790 ATACATGCCATGTAACAGGTAGG - Intronic
1025272242 7:57533938-57533960 ATACAAGTTAAGATGCACGTTGG - Intergenic
1026966570 7:74443921-74443943 ATACTTGGCCAGAAGCAGGAGGG - Intergenic
1028249422 7:88523496-88523518 AGACATGTTCAGAAACAGGTCGG - Intergenic
1028650324 7:93143595-93143617 AGAAAAGTGAAGAAGCAGGTCGG - Intronic
1029366985 7:100122889-100122911 ACATACCTCAAGAAGCAGGTAGG + Exonic
1031356243 7:120790432-120790454 ATACATGTTAAGAACCCAGTAGG + Intronic
1033030899 7:137825377-137825399 ATACATGTGATGAAGCATGGTGG + Intronic
1033091526 7:138390495-138390517 AAACATTTAAAGAAGCAGATTGG - Intergenic
1033111340 7:138580474-138580496 ATAGATGTCATGGAGGAGGTGGG + Intronic
1035597699 8:871840-871862 ATACATGCCAACAAGTAGGTGGG - Intergenic
1038598363 8:28911649-28911671 ATAAAAGTCAAGCAGCAGCTAGG - Intronic
1039147296 8:34463242-34463264 ATACATGCCAAGCAGCTGGATGG + Intergenic
1040379260 8:46856461-46856483 ATATATGTAAAGAAGCACCTAGG + Intergenic
1041706785 8:60854910-60854932 TTCCAAGTCAAGAAGCTGGTAGG - Intronic
1042370837 8:67988773-67988795 GTACATGACAAGAAGGTGGTGGG + Intronic
1043031357 8:75137351-75137373 TTAAAAGTCAAGAAGCAGTTTGG - Intergenic
1045063169 8:98425623-98425645 ACACATGTCCAGAAGCCAGTGGG + Intronic
1046644150 8:116766622-116766644 AAACATGCCAAGAAGCATCTTGG + Exonic
1049175899 8:141192646-141192668 ATCCGGGTGAAGAAGCAGGTAGG + Exonic
1050048774 9:1576156-1576178 ATACCTGTCAAGCACCAGGCCGG - Intergenic
1051577800 9:18637073-18637095 ATACATGTCATGGAAGAGGTGGG + Intronic
1055956001 9:81773971-81773993 ATACAAGAGGAGAAGCAGGTTGG - Intergenic
1059219954 9:112606033-112606055 ATACATGTCAGGAATTAAGTAGG - Intronic
1059389871 9:113992383-113992405 ATACACTTTCAGAAGCAGGTAGG - Intronic
1061702555 9:132427111-132427133 ATACATTTTAAGACACAGGTGGG + Intronic
1187096152 X:16150639-16150661 ATACATGTCAAGAAGCAGGTAGG + Exonic
1187585568 X:20657659-20657681 ATATTGGTCAAGAAGCAGTTGGG + Intergenic
1188339069 X:28976812-28976834 ATAGAAGTCAAGAAGAAGTTAGG + Intronic
1192096328 X:68215244-68215266 ATACATGTCAAAAAAAATGTGGG + Intronic
1193185526 X:78507701-78507723 ATACAGGTCACCAAGGAGGTGGG - Intergenic
1194227295 X:91276634-91276656 ATAGATGTCAAGAAACTGATTGG + Intergenic
1194762968 X:97816236-97816258 CACCATGCCAAGAAGCAGGTAGG + Intergenic
1196010013 X:110876712-110876734 GTACATGAAAGGAAGCAGGTAGG + Intergenic
1198389633 X:136161230-136161252 ATAGGTGGCAAGAAGCAGGTGGG - Intronic
1198992260 X:142528162-142528184 ATACAATTCAAGATGCAGTTTGG + Intergenic
1199591420 X:149471388-149471410 AGAAATGTCAAAAAGCAGGTTGG + Intergenic
1200241825 X:154500193-154500215 ATACAAGTGAAGAAGCTGGCTGG + Intergenic
1201264934 Y:12197037-12197059 ACACACTTCAAAAAGCAGGTGGG - Intergenic