ID: 1187096888

View in Genome Browser
Species Human (GRCh38)
Location X:16158127-16158149
Sequence CCTCAGACACAGAACTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187096888_1187096892 -2 Left 1187096888 X:16158127-16158149 CCCACCTAGTTCTGTGTCTGAGG No data
Right 1187096892 X:16158148-16158170 GGAGAGAAAAAAACTTGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187096888 Original CRISPR CCTCAGACACAGAACTAGGT GGG (reversed) Intergenic
No off target data available for this crispr