ID: 1187102030

View in Genome Browser
Species Human (GRCh38)
Location X:16203042-16203064
Sequence CACAGCTTCCAACTAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187102030_1187102037 30 Left 1187102030 X:16203042-16203064 CCTCTATTTAGTTGGAAGCTGTG No data
Right 1187102037 X:16203095-16203117 GTGTTTTTCACTGCTCACCTTGG No data
1187102030_1187102032 8 Left 1187102030 X:16203042-16203064 CCTCTATTTAGTTGGAAGCTGTG No data
Right 1187102032 X:16203073-16203095 TAACCTTTGATCCCAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187102030 Original CRISPR CACAGCTTCCAACTAAATAG AGG (reversed) Intergenic
No off target data available for this crispr