ID: 1187109803

View in Genome Browser
Species Human (GRCh38)
Location X:16285329-16285351
Sequence AAAAATCCACAGAGACAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187109802_1187109803 -8 Left 1187109802 X:16285314-16285336 CCAAAATGTAAGAAGAAAAATCC No data
Right 1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG No data
1187109801_1187109803 -7 Left 1187109801 X:16285313-16285335 CCCAAAATGTAAGAAGAAAAATC No data
Right 1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG No data
1187109800_1187109803 -6 Left 1187109800 X:16285312-16285334 CCCCAAAATGTAAGAAGAAAAAT No data
Right 1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187109803 Original CRISPR AAAAATCCACAGAGACAGCT CGG Intergenic
No off target data available for this crispr