ID: 1187115765

View in Genome Browser
Species Human (GRCh38)
Location X:16348856-16348878
Sequence GCTTCTTTGCATCAGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187115765_1187115768 6 Left 1187115765 X:16348856-16348878 CCTTCCTTCTGATGCAAAGAAGC No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data
1187115765_1187115769 16 Left 1187115765 X:16348856-16348878 CCTTCCTTCTGATGCAAAGAAGC No data
Right 1187115769 X:16348895-16348917 ATAACCTACAAGGACTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187115765 Original CRISPR GCTTCTTTGCATCAGAAGGA AGG (reversed) Intergenic
No off target data available for this crispr