ID: 1187115768

View in Genome Browser
Species Human (GRCh38)
Location X:16348885-16348907
Sequence TGTTCAGTCAATAACCTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187115765_1187115768 6 Left 1187115765 X:16348856-16348878 CCTTCCTTCTGATGCAAAGAAGC No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data
1187115762_1187115768 28 Left 1187115762 X:16348834-16348856 CCCTGCTCAGATTCTCCAGTGAC No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data
1187115763_1187115768 27 Left 1187115763 X:16348835-16348857 CCTGCTCAGATTCTCCAGTGACC No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data
1187115764_1187115768 13 Left 1187115764 X:16348849-16348871 CCAGTGACCTTCCTTCTGATGCA No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data
1187115766_1187115768 2 Left 1187115766 X:16348860-16348882 CCTTCTGATGCAAAGAAGCAGCC No data
Right 1187115768 X:16348885-16348907 TGTTCAGTCAATAACCTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187115768 Original CRISPR TGTTCAGTCAATAACCTACA AGG Intergenic
No off target data available for this crispr