ID: 1187115769

View in Genome Browser
Species Human (GRCh38)
Location X:16348895-16348917
Sequence ATAACCTACAAGGACTTAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187115765_1187115769 16 Left 1187115765 X:16348856-16348878 CCTTCCTTCTGATGCAAAGAAGC No data
Right 1187115769 X:16348895-16348917 ATAACCTACAAGGACTTAAGTGG No data
1187115764_1187115769 23 Left 1187115764 X:16348849-16348871 CCAGTGACCTTCCTTCTGATGCA No data
Right 1187115769 X:16348895-16348917 ATAACCTACAAGGACTTAAGTGG No data
1187115766_1187115769 12 Left 1187115766 X:16348860-16348882 CCTTCTGATGCAAAGAAGCAGCC No data
Right 1187115769 X:16348895-16348917 ATAACCTACAAGGACTTAAGTGG No data
1187115767_1187115769 -9 Left 1187115767 X:16348881-16348903 CCAATGTTCAGTCAATAACCTAC No data
Right 1187115769 X:16348895-16348917 ATAACCTACAAGGACTTAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187115769 Original CRISPR ATAACCTACAAGGACTTAAG TGG Intergenic
No off target data available for this crispr