ID: 1187116118

View in Genome Browser
Species Human (GRCh38)
Location X:16353077-16353099
Sequence GTACAGGCCTTGGCAAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187116118_1187116120 -8 Left 1187116118 X:16353077-16353099 CCATAATTTGCCAAGGCCTGTAC No data
Right 1187116120 X:16353092-16353114 GCCTGTACTAGAGAGAGAAGAGG No data
1187116118_1187116123 -2 Left 1187116118 X:16353077-16353099 CCATAATTTGCCAAGGCCTGTAC No data
Right 1187116123 X:16353098-16353120 ACTAGAGAGAGAAGAGGAAAGGG No data
1187116118_1187116122 -3 Left 1187116118 X:16353077-16353099 CCATAATTTGCCAAGGCCTGTAC No data
Right 1187116122 X:16353097-16353119 TACTAGAGAGAGAAGAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187116118 Original CRISPR GTACAGGCCTTGGCAAATTA TGG (reversed) Intergenic
No off target data available for this crispr