ID: 1187119038

View in Genome Browser
Species Human (GRCh38)
Location X:16385403-16385425
Sequence GAGGCCATTTTGGACTTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187119038_1187119041 -3 Left 1187119038 X:16385403-16385425 CCAATCAAGTCCAAAATGGCCTC No data
Right 1187119041 X:16385423-16385445 CTCCTAAATGTATTTTTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187119038 Original CRISPR GAGGCCATTTTGGACTTGAT TGG (reversed) Intergenic
No off target data available for this crispr