ID: 1187122570

View in Genome Browser
Species Human (GRCh38)
Location X:16423493-16423515
Sequence TCTTATGATTAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187122570_1187122573 -9 Left 1187122570 X:16423493-16423515 CCTTCCTCCTTCTAATCATAAGA No data
Right 1187122573 X:16423507-16423529 ATCATAAGATCAGCACCCACTGG No data
1187122570_1187122574 4 Left 1187122570 X:16423493-16423515 CCTTCCTCCTTCTAATCATAAGA No data
Right 1187122574 X:16423520-16423542 CACCCACTGGCCAAACTAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187122570 Original CRISPR TCTTATGATTAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr