ID: 1187122893

View in Genome Browser
Species Human (GRCh38)
Location X:16426394-16426416
Sequence CCAATCCCACAAAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187122886_1187122893 23 Left 1187122886 X:16426348-16426370 CCCCATTCTACAAAAGAGGAATC No data
Right 1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG No data
1187122887_1187122893 22 Left 1187122887 X:16426349-16426371 CCCATTCTACAAAAGAGGAATCA No data
Right 1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG No data
1187122888_1187122893 21 Left 1187122888 X:16426350-16426372 CCATTCTACAAAAGAGGAATCAG No data
Right 1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG No data
1187122885_1187122893 24 Left 1187122885 X:16426347-16426369 CCCCCATTCTACAAAAGAGGAAT No data
Right 1187122893 X:16426394-16426416 CCAATCCCACAAAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187122893 Original CRISPR CCAATCCCACAAAGAGAAGA AGG Intergenic
No off target data available for this crispr