ID: 1187124026

View in Genome Browser
Species Human (GRCh38)
Location X:16436602-16436624
Sequence GGGGGCACATAGTCTAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187124023_1187124026 -4 Left 1187124023 X:16436583-16436605 CCTGGCTGCTGCGCTAGGAGGGG No data
Right 1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG No data
1187124021_1187124026 -3 Left 1187124021 X:16436582-16436604 CCCTGGCTGCTGCGCTAGGAGGG No data
Right 1187124026 X:16436602-16436624 GGGGGCACATAGTCTAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187124026 Original CRISPR GGGGGCACATAGTCTAAGCT TGG Intergenic
No off target data available for this crispr