ID: 1187128576

View in Genome Browser
Species Human (GRCh38)
Location X:16478568-16478590
Sequence TATTAAGTCTGGAATATCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187128576_1187128583 26 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128583 X:16478617-16478639 GTTAATGGTTAGAGAAAACAAGG No data
1187128576_1187128581 -1 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128581 X:16478590-16478612 AAACAGAATGAGGAAGGAAAGGG No data
1187128576_1187128579 -7 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG No data
1187128576_1187128582 11 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128582 X:16478602-16478624 GAAGGAAAGGGATGAGTTAATGG No data
1187128576_1187128580 -2 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128580 X:16478589-16478611 TAAACAGAATGAGGAAGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187128576 Original CRISPR TATTAAGTCTGGAATATCCC TGG (reversed) Intergenic
No off target data available for this crispr