ID: 1187128579

View in Genome Browser
Species Human (GRCh38)
Location X:16478584-16478606
Sequence CTTAATAAACAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187128576_1187128579 -7 Left 1187128576 X:16478568-16478590 CCAGGGATATTCCAGACTTAATA No data
Right 1187128579 X:16478584-16478606 CTTAATAAACAGAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187128579 Original CRISPR CTTAATAAACAGAATGAGGA AGG Intergenic
No off target data available for this crispr