ID: 1187136549

View in Genome Browser
Species Human (GRCh38)
Location X:16552706-16552728
Sequence CCCCCAACTGAGGTGGTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187136549_1187136558 21 Left 1187136549 X:16552706-16552728 CCCCATACCACCTCAGTTGGGGG No data
Right 1187136558 X:16552750-16552772 CATTGTTGAGTAATTCTGGATGG No data
1187136549_1187136556 17 Left 1187136549 X:16552706-16552728 CCCCATACCACCTCAGTTGGGGG No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187136549 Original CRISPR CCCCCAACTGAGGTGGTATG GGG (reversed) Intergenic
No off target data available for this crispr