ID: 1187136553

View in Genome Browser
Species Human (GRCh38)
Location X:16552713-16552735
Sequence CTTCTCTCCCCCAACTGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187136553_1187136558 14 Left 1187136553 X:16552713-16552735 CCACCTCAGTTGGGGGAGAGAAG No data
Right 1187136558 X:16552750-16552772 CATTGTTGAGTAATTCTGGATGG No data
1187136553_1187136556 10 Left 1187136553 X:16552713-16552735 CCACCTCAGTTGGGGGAGAGAAG No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187136553 Original CRISPR CTTCTCTCCCCCAACTGAGG TGG (reversed) Intergenic
No off target data available for this crispr