ID: 1187136556

View in Genome Browser
Species Human (GRCh38)
Location X:16552746-16552768
Sequence GTTCCATTGTTGAGTAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187136552_1187136556 15 Left 1187136552 X:16552708-16552730 CCATACCACCTCAGTTGGGGGAG No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data
1187136551_1187136556 16 Left 1187136551 X:16552707-16552729 CCCATACCACCTCAGTTGGGGGA No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data
1187136549_1187136556 17 Left 1187136549 X:16552706-16552728 CCCCATACCACCTCAGTTGGGGG No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data
1187136555_1187136556 7 Left 1187136555 X:16552716-16552738 CCTCAGTTGGGGGAGAGAAGGAT No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data
1187136553_1187136556 10 Left 1187136553 X:16552713-16552735 CCACCTCAGTTGGGGGAGAGAAG No data
Right 1187136556 X:16552746-16552768 GTTCCATTGTTGAGTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187136556 Original CRISPR GTTCCATTGTTGAGTAATTC TGG Intergenic
No off target data available for this crispr