ID: 1187138924

View in Genome Browser
Species Human (GRCh38)
Location X:16574982-16575004
Sequence TTTTCCTGTCACAAGATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187138924_1187138927 12 Left 1187138924 X:16574982-16575004 CCATTAATCTTGTGACAGGAAAA No data
Right 1187138927 X:16575017-16575039 CCCCAAAATCACTAAGCTAACGG 0: 144
1: 390
2: 518
3: 486
4: 480
1187138924_1187138931 27 Left 1187138924 X:16574982-16575004 CCATTAATCTTGTGACAGGAAAA No data
Right 1187138931 X:16575032-16575054 GCTAACGGGAAAAGTCAAGCTGG No data
1187138924_1187138929 13 Left 1187138924 X:16574982-16575004 CCATTAATCTTGTGACAGGAAAA No data
Right 1187138929 X:16575018-16575040 CCCAAAATCACTAAGCTAACGGG No data
1187138924_1187138932 28 Left 1187138924 X:16574982-16575004 CCATTAATCTTGTGACAGGAAAA No data
Right 1187138932 X:16575033-16575055 CTAACGGGAAAAGTCAAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187138924 Original CRISPR TTTTCCTGTCACAAGATTAA TGG (reversed) Intergenic
No off target data available for this crispr