ID: 1187142020

View in Genome Browser
Species Human (GRCh38)
Location X:16602955-16602977
Sequence CAAGCTGGCTTCTTTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 163}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187142015_1187142020 4 Left 1187142015 X:16602928-16602950 CCAAAATAAGGCCAGTGGGTGCC 0: 1
1: 0
2: 0
3: 16
4: 142
Right 1187142020 X:16602955-16602977 CAAGCTGGCTTCTTTGACCTTGG 0: 1
1: 0
2: 2
3: 11
4: 163
1187142016_1187142020 -7 Left 1187142016 X:16602939-16602961 CCAGTGGGTGCCCTTTCAAGCTG 0: 1
1: 0
2: 21
3: 91
4: 317
Right 1187142020 X:16602955-16602977 CAAGCTGGCTTCTTTGACCTTGG 0: 1
1: 0
2: 2
3: 11
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187142020 Original CRISPR CAAGCTGGCTTCTTTGACCT TGG Intronic
902183440 1:14707245-14707267 CATGCTGGCTTCTCTGAACCAGG + Intronic
904768890 1:32870347-32870369 CTAGCTCCCTTCTTTGACCCAGG - Intronic
906060734 1:42946879-42946901 CAAGCTGCCTCCTTTCACCTTGG + Intronic
906812901 1:48847362-48847384 GAAAGTGCCTTCTTTGACCTTGG - Intronic
907045190 1:51296346-51296368 GAAGGTGGCTGCTTTGACATGGG - Intronic
908328584 1:63048298-63048320 CTCACTGGCTTCTTTGACTTAGG - Intergenic
909584212 1:77270864-77270886 CAGTTTGGCTTCTTTCACCTGGG + Intergenic
912227507 1:107751708-107751730 CAGGCTGGCTTTCTTGAGCTAGG + Intronic
913397635 1:118389540-118389562 CTAGCTGGTTTCCTTGACTTTGG + Intergenic
914579816 1:149009514-149009536 CAGGTTGGCTTCGGTGACCTTGG + Intronic
915824269 1:159058379-159058401 GAAGCTGGCCTCCTTGACCTGGG + Intergenic
919156523 1:193773171-193773193 CAGGCTGGGTTCTCAGACCTGGG - Intergenic
919578003 1:199336517-199336539 CAGTCTGGCTACTTTGTCCTAGG + Intergenic
920185089 1:204154519-204154541 AGAGCTGGCTTCTGTGAGCTGGG + Intergenic
921900669 1:220447142-220447164 TAAGCTGGCTTCTTTGTTGTGGG + Intergenic
921994853 1:221407016-221407038 CAATCTTGATTCTTTGAGCTGGG + Intergenic
923701473 1:236303961-236303983 CAAACCTGCTTCTTTGCCCTGGG + Intergenic
1066131839 10:32402003-32402025 CAAGCTGGCTCCTCTGTCCTTGG - Intergenic
1066428508 10:35331131-35331153 CCAGCTGTCATCTTTGAGCTGGG + Intronic
1066459783 10:35603129-35603151 CCAGCTGGTTTCTTTGGCCATGG + Intergenic
1069951416 10:72021048-72021070 CAGGCTGGGTACTTTGCCCTAGG - Intergenic
1070791037 10:79189566-79189588 CTTGCTGGCTTCTGTGCCCTGGG - Intronic
1071998511 10:91170969-91170991 CAGATTGGCTTCTTTGACTTAGG - Intronic
1072755557 10:98018587-98018609 CAACCTGGATTCTCTGACGTGGG + Intronic
1074853592 10:117457494-117457516 CTAGCTGGCCTCTATGGCCTGGG - Intergenic
1075823175 10:125331349-125331371 CCAGATGGCCACTTTGACCTTGG - Intergenic
1075827790 10:125374699-125374721 CAAGATGGCTTCATTGACTGTGG + Intergenic
1078541366 11:12216024-12216046 GAAGCTAGCTGCTTTGACTTGGG + Intronic
1080855099 11:36105306-36105328 CAAGTTGGCATTTTTGTCCTTGG + Intronic
1081915503 11:46727898-46727920 CCAGCTGGGTTCTTAGACCTGGG + Intronic
1081916279 11:46732770-46732792 CAAGCTGGCTTCTGTGACTTGGG + Intronic
1085455935 11:76665423-76665445 CAAGCTGGGCTCCTTGACTTGGG - Intronic
1085840407 11:80005209-80005231 CTAGCTGGCCTCTTTGTCTTTGG + Intergenic
1089262296 11:117231759-117231781 CAAGCTGGCTTCTAGGAGCCGGG - Intronic
1090569175 11:128028782-128028804 CAAGATGGCTGCTCTGACATAGG + Intergenic
1090750260 11:129740693-129740715 CAAGCAGGCTGCTCTGACCCTGG + Intergenic
1091121176 11:133058911-133058933 CAAGCTTGCCTCACTGACCTAGG + Intronic
1091188600 11:133669930-133669952 CTTGCTGGCTTCTCTGACTTGGG + Intergenic
1092820389 12:12348431-12348453 CAGACTGGCTTCTTTGACTTAGG - Intronic
1094700532 12:32866322-32866344 GTAGCTGGCTCCTTTGAACTTGG + Intronic
1095546812 12:43381569-43381591 CAAGCTGGTTTCTTACTCCTGGG - Intronic
1095681201 12:44978119-44978141 CAAGCTGCCTTTTTTGACAGTGG - Intergenic
1100613547 12:96212649-96212671 CCAGTTGGCTGCTTTGATCTAGG + Intronic
1101004066 12:100384680-100384702 CAGGCTGGCTTCTGCGTCCTGGG - Intronic
1101018736 12:100530119-100530141 AAAGCTGCATTCTCTGACCTGGG - Intronic
1102443270 12:112979654-112979676 CAAGCTGGACACTTTGATCTGGG - Intronic
1102696721 12:114805596-114805618 CAAGATGACTTCTTTGAAGTGGG + Intergenic
1107380677 13:39853891-39853913 CAAGCAGGCCTCCTTGAGCTGGG + Intergenic
1108095858 13:46899990-46900012 CAAGCTGGCTTCCTTGGCTGAGG - Intergenic
1113771837 13:112915072-112915094 CAAGTTTGCTTTTCTGACCTGGG + Intronic
1117261707 14:54041641-54041663 CAGGCTTGTTTCTGTGACCTTGG + Intergenic
1117584144 14:57182927-57182949 GAATCTCGGTTCTTTGACCTTGG - Intergenic
1117654566 14:57941413-57941435 GCATCTGGCTTCTTTGACTTAGG - Intronic
1118069189 14:62226628-62226650 GAAACTGGCTTCTTTAACCCAGG + Intergenic
1120249603 14:82046578-82046600 GATGCTGGCTTCTGTGACTTCGG + Intergenic
1120336581 14:83164678-83164700 AAAGATAGCTTCCTTGACCTTGG - Intergenic
1121310819 14:92934108-92934130 AAGGCTGCCTCCTTTGACCTGGG - Intronic
1127579098 15:60320765-60320787 CAGGCTGACTTCTTTCCCCTAGG + Intergenic
1130026334 15:80273699-80273721 CAAGATGTCTTTTTTGACCAGGG - Intergenic
1130303337 15:82696995-82697017 CAAGCTGGGTTCTTGTGCCTGGG - Intronic
1131401360 15:92128110-92128132 CAAGCTGGCATCATTGGCCAGGG + Intronic
1131768093 15:95702008-95702030 CATACTGGCTTCTTAGACTTAGG + Intergenic
1132361130 15:101216603-101216625 CATACTGGATTCTTTCACCTAGG - Intronic
1133097003 16:3454162-3454184 CAAGCAGGCTTCTCTGGCCCAGG - Intronic
1136115859 16:28093910-28093932 CTAGCTGGCTCCTTGGGCCTGGG - Intergenic
1137621529 16:49879648-49879670 CAAGGTGGCTGTTTTCACCTGGG - Intergenic
1137835865 16:51591938-51591960 AAAGCTGTCTTCTTTGTCCCTGG - Intergenic
1139407463 16:66730439-66730461 CATACTGGCTCCTTAGACCTTGG - Intronic
1140211910 16:72977194-72977216 CATCCTGGTTTCTTTGGCCTTGG + Intronic
1141225110 16:82107611-82107633 TAAGCTTACTTCTTTGAGCTGGG + Intergenic
1141498557 16:84427364-84427386 GCAACTGGCTTCTTTCACCTAGG - Intronic
1146666603 17:34709199-34709221 CAAGCTGGCCTCTTTGTTCCTGG + Intergenic
1149775607 17:59354558-59354580 CCAGCTGGCTGATTTGACCTAGG + Intronic
1151278857 17:73056649-73056671 CAAGCCAGCTTGTTTGACCCAGG - Intronic
1152127901 17:78458451-78458473 CAACCTGGCTGCTTCCACCTGGG + Intronic
1153018884 18:608766-608788 CAATCTGTCTCCTTTGGCCTGGG + Intronic
1155022474 18:21909324-21909346 CAAGATGGCTTCATGGAGCTAGG - Intergenic
1156248794 18:35330758-35330780 CAAGCTGTCTTCTCACACCTCGG - Intergenic
1158817685 18:61122417-61122439 GAACCTGACTTCTTTGATCTAGG - Intergenic
1159464681 18:68766209-68766231 TAATCTTGCTTCTTTGTCCTAGG - Intronic
1159655638 18:71028305-71028327 AAAGCTGGCTCATATGACCTTGG + Intergenic
1159956432 18:74521546-74521568 CAGGCTGGCTCCTGTGTCCTTGG - Exonic
1161136128 19:2620883-2620905 GAGGCTGGGTTCTGTGACCTTGG + Intronic
1162478602 19:10915368-10915390 CAAGCTGGCTGCTGGGACGTCGG - Intronic
1163240336 19:16058903-16058925 AAAGCTGCCTTCTTTGGCTTAGG - Intergenic
1163335487 19:16668727-16668749 CAGACTGGCTTCTTTCACTTAGG + Intronic
1164744732 19:30602798-30602820 GAATCTGGCTGCTGTGACCTGGG + Intronic
1167205014 19:48095556-48095578 CACGCTGGCTTCTCTGCACTGGG - Exonic
927441563 2:23122102-23122124 CAAGCCAGCCTCTCTGACCTTGG - Intergenic
928835297 2:35536984-35537006 AAATCTGAGTTCTTTGACCTAGG - Intergenic
930139605 2:47938525-47938547 CAAGCTGGCTTCTATGCCTGGGG + Intergenic
935381031 2:102451376-102451398 CAAGCAGGCTTCTCAGGCCTGGG + Intronic
936961599 2:118080791-118080813 CTACCAGGCTCCTTTGACCTTGG - Intergenic
942970364 2:181950835-181950857 CAATGTAGTTTCTTTGACCTTGG - Intergenic
943884217 2:193192817-193192839 GAGTCTGGCTTCTTTCACCTAGG + Intergenic
945155127 2:206830162-206830184 CGATCTGGCTTCTTTGACAATGG - Intergenic
948092239 2:235303927-235303949 CAGGCTGGCAGCTGTGACCTGGG - Intergenic
948315303 2:237024050-237024072 CTGGCTGCCTTCTTGGACCTAGG - Intergenic
948716847 2:239870692-239870714 GATGCTGGCTTCTCTAACCTGGG - Intergenic
1171345486 20:24462679-24462701 CATGCTGGCTTCTGTTCCCTGGG - Intergenic
1175153989 20:56957338-56957360 CCAGCCGGCTTCCTTGACCAGGG - Intergenic
1175725124 20:61312884-61312906 CAAGCTCGCTTCTCTGCACTGGG - Intronic
1179471414 21:41613139-41613161 GAAGCTGGCTCCTTAGGCCTGGG + Intergenic
1181745039 22:24950387-24950409 CGAGCTGGCATCTCTCACCTAGG + Intergenic
1182028402 22:27138194-27138216 CCAGATGGCTCCTTTGTCCTGGG - Intergenic
1182333911 22:29570502-29570524 CCAGCTGCCTTCATTGTCCTTGG + Exonic
1184013822 22:41770307-41770329 CAAGCTGGGTTTCTTGACCTCGG + Intronic
1184976329 22:48065044-48065066 AAAGATGGATGCTTTGACCTTGG - Intergenic
953302927 3:41796940-41796962 CAAGATGACTTCTGTGTCCTTGG - Intronic
953589847 3:44241459-44241481 CAAGCTTGCTCCTTTCACATAGG - Intergenic
959566442 3:107837313-107837335 CATGTTGGCTTCAGTGACCTTGG - Intergenic
960905946 3:122601530-122601552 CAGACTGACTTCTTTCACCTAGG + Intronic
961529782 3:127533445-127533467 CAAGCTGCCTCCTCTGTCCTGGG - Intergenic
968679629 4:1908225-1908247 CAACCTGGCCTTTCTGACCTAGG - Intronic
970355500 4:15247100-15247122 CAAGCTGGCTTAATTGTCCAAGG - Intergenic
970836443 4:20414328-20414350 CAAGTTGCCTTGTTAGACCTAGG - Intronic
971251793 4:24978844-24978866 TCTGCTGGCTTCTCTGACCTGGG + Intronic
971898518 4:32627604-32627626 CCAGCTGGCTTCATAGCCCTGGG + Intergenic
972519146 4:39837296-39837318 GAAGGTGGCTCCTTTCACCTTGG - Intronic
973204838 4:47548924-47548946 CAAGCTGGCATTCTTAACCTGGG - Intronic
974372934 4:61041356-61041378 CAAACTTGTTTCTTTTACCTGGG - Intergenic
975580101 4:75898479-75898501 CAAGCTGGCTTCTTTAAGGAAGG - Intronic
978088359 4:104683614-104683636 CAAGTTAGCTTCTTTGCCTTGGG - Intergenic
978608085 4:110504293-110504315 CAAACTGGCTTCTTTTCCTTAGG + Intronic
979344827 4:119574673-119574695 AAAGCTGGTTTCTTGGACTTAGG + Intronic
979978260 4:127223646-127223668 CAAGCTGGCTTCATCCCCCTGGG - Intergenic
980314767 4:131184268-131184290 CCAGATGTCTTCATTGACCTAGG + Intergenic
989212988 5:38875610-38875632 CTAGCTTCCTTCTTTGAGCTAGG + Intronic
989368357 5:40680294-40680316 AAAGCTGGCAACTCTGACCTCGG + Exonic
993699384 5:91100068-91100090 CAAGATGGTTTCTGTGACTTTGG - Intronic
994720253 5:103372198-103372220 CCAGCTTGCTTCTCTGGCCTTGG - Intergenic
995991517 5:118245799-118245821 CAAGTTTCCTTCATTGACCTTGG + Intergenic
1002211321 5:177600915-177600937 CAAGCTCGCATCTTTCACGTAGG - Intronic
1004149570 6:13102914-13102936 CAAGCTGGCTTCTTGGACCAAGG - Intronic
1006182913 6:32164639-32164661 CCACCTGGCTTCTTTCTCCTGGG - Exonic
1007029487 6:38615186-38615208 CATGCAGCCTTCCTTGACCTGGG + Intronic
1007132689 6:39491233-39491255 CAATCTGGCTGCTTTGATGTTGG + Intronic
1007497332 6:42269146-42269168 CAAGCTGGACTCTTTCACCCAGG - Exonic
1009792111 6:68416994-68417016 CAGGCTGCCTTCTCTGACATAGG + Intergenic
1016643784 6:146380477-146380499 CAAGCTGACTTCAGAGACCTTGG - Intronic
1017078808 6:150646532-150646554 CAAACTGGCTTCTATGAAGTGGG - Intronic
1017351605 6:153449057-153449079 CAGGCGTGCTTCCTTGACCTCGG - Intergenic
1017981220 6:159402296-159402318 CAAGCTGGCTTCATGGGCCCAGG - Intergenic
1018277493 6:162148571-162148593 CAATCTGGCTTATATCACCTTGG - Intronic
1018928193 6:168221825-168221847 CCAGCAGCCCTCTTTGACCTGGG - Intergenic
1019032738 6:169026283-169026305 AAAGCTGCCTTCCTTGACCTTGG - Intergenic
1019219742 6:170464122-170464144 CAGGCAGGCTGCTTTGGCCTGGG - Intergenic
1021791837 7:24213664-24213686 CAACATGGCTTCTTTGACAAGGG + Intergenic
1027385058 7:77651638-77651660 CAAGTTGGATTCTTTGACTAAGG + Intergenic
1029420023 7:100467534-100467556 CAAGATGGCTTCTCTTACCATGG + Exonic
1030165129 7:106546953-106546975 CAAGCTGCTTTATTTGTCCTTGG - Intergenic
1035849349 8:2899791-2899813 CAAATTGGCTTCTTTCACTTAGG - Intergenic
1035931763 8:3787631-3787653 CAAGCTGCCTTATTTCTCCTTGG - Intronic
1041716244 8:60934932-60934954 CAAGGAGGCTACTGTGACCTTGG - Intergenic
1043167255 8:76919606-76919628 CAAACTGTCTTCTTTAACCTTGG + Intergenic
1043978421 8:86609381-86609403 CAATCTGCCTTCTTTTAACTTGG + Intronic
1048635795 8:136293868-136293890 AAAACAGGCTTCTGTGACCTTGG + Intergenic
1050611384 9:7357607-7357629 CAAGATATCTTATTTGACCTGGG + Intergenic
1052645612 9:31230126-31230148 CAGGCAGGCTTCCTTGAGCTGGG + Intergenic
1054855424 9:69894059-69894081 GAAACAGGCTTCTTTGACTTGGG + Intronic
1055302090 9:74892347-74892369 CAAGCTGACTTCAGAGACCTTGG + Intergenic
1055589088 9:77791020-77791042 CAAGGTGGATTCCCTGACCTTGG - Intronic
1056340808 9:85630087-85630109 CAAGATGACATCTTTGACTTTGG + Intronic
1056902383 9:90611915-90611937 CAGGCAGGCTTCTCTGCCCTGGG - Exonic
1059246117 9:112850941-112850963 CCAGGTGGCTTCCCTGACCTTGG - Exonic
1060023463 9:120151511-120151533 CAAGCTGCCTTCTTTCTCCTAGG - Intergenic
1061874453 9:133536906-133536928 CAAGATGGGTTCTGGGACCTGGG - Intronic
1061896645 9:133651872-133651894 CAGGCTGGCTTCTTTTTCCTGGG + Intronic
1186101688 X:6164171-6164193 GAAACTGGCTTATTTGACATTGG - Intronic
1187142020 X:16602955-16602977 CAAGCTGGCTTCTTTGACCTTGG + Intronic
1192910786 X:75602110-75602132 CAGGCAGGCCTCCTTGACCTGGG + Intergenic
1193043438 X:77027578-77027600 CAAGCTGCCTTGTTTCATCTAGG + Intergenic
1193080739 X:77403815-77403837 GATGCGGGCCTCTTTGACCTTGG - Intergenic
1194974389 X:100378998-100379020 ACAGCTGGATTCTCTGACCTTGG + Intronic
1195656987 X:107341156-107341178 CAAGCTGCTATCTTGGACCTTGG - Intergenic
1195755720 X:108196971-108196993 CAAGCTGCCTTCTATCATCTAGG + Intronic
1195818114 X:108910374-108910396 CAAGGTTGCTTATTTCACCTGGG - Intergenic