ID: 1187143060

View in Genome Browser
Species Human (GRCh38)
Location X:16613038-16613060
Sequence ACTTCCAGAGTCCCGAGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187143060_1187143061 3 Left 1187143060 X:16613038-16613060 CCTCTGCTCGGGACTCTGGAAGT No data
Right 1187143061 X:16613064-16613086 TGAACAGATTAGAGACAAAAAGG No data
1187143060_1187143062 22 Left 1187143060 X:16613038-16613060 CCTCTGCTCGGGACTCTGGAAGT No data
Right 1187143062 X:16613083-16613105 AAGGAAAAGAGACAGAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187143060 Original CRISPR ACTTCCAGAGTCCCGAGCAG AGG (reversed) Intronic