ID: 1187145241

View in Genome Browser
Species Human (GRCh38)
Location X:16631090-16631112
Sequence TGTAATCTCAGTACTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 412788
Summary {0: 7, 1: 223, 2: 4133, 3: 45828, 4: 362597}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187145234_1187145241 22 Left 1187145234 X:16631045-16631067 CCTCATCTCTACAAAAATTTTAG 0: 2
1: 131
2: 1506
3: 6181
4: 29928
Right 1187145241 X:16631090-16631112 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597
1187145238_1187145241 -2 Left 1187145238 X:16631069-16631091 CCAGGCACAGTGGCTCATGCCTG 0: 7444
1: 30963
2: 79445
3: 137491
4: 151300
Right 1187145241 X:16631090-16631112 TGTAATCTCAGTACTTCAGGAGG 0: 7
1: 223
2: 4133
3: 45828
4: 362597

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187145241 Original CRISPR TGTAATCTCAGTACTTCAGG AGG Intronic
Too many off-targets to display for this crispr