ID: 1187146776

View in Genome Browser
Species Human (GRCh38)
Location X:16644426-16644448
Sequence CTCAATTTACAGGCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 816
Summary {0: 1, 1: 0, 2: 4, 3: 93, 4: 718}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187146776_1187146785 11 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146785 X:16644460-16644482 GGGAAGATTCTGGATTATCAGGG 0: 1
1: 0
2: 4
3: 28
4: 342
1187146776_1187146782 -9 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146782 X:16644440-16644462 TAAATTGAGGCTCTTGAGAAGGG 0: 1
1: 0
2: 9
3: 104
4: 483
1187146776_1187146781 -10 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146781 X:16644439-16644461 GTAAATTGAGGCTCTTGAGAAGG 0: 1
1: 0
2: 11
3: 96
4: 494
1187146776_1187146784 10 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146784 X:16644459-16644481 AGGGAAGATTCTGGATTATCAGG 0: 1
1: 0
2: 1
3: 50
4: 384
1187146776_1187146787 15 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146787 X:16644464-16644486 AGATTCTGGATTATCAGGGTGGG 0: 1
1: 0
2: 9
3: 108
4: 718
1187146776_1187146786 14 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146786 X:16644463-16644485 AAGATTCTGGATTATCAGGGTGG 0: 1
1: 0
2: 13
3: 90
4: 557
1187146776_1187146783 1 Left 1187146776 X:16644426-16644448 CCATGCCCAGCCTGTAAATTGAG 0: 1
1: 0
2: 4
3: 93
4: 718
Right 1187146783 X:16644450-16644472 CTCTTGAGAAGGGAAGATTCTGG 0: 1
1: 0
2: 1
3: 22
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187146776 Original CRISPR CTCAATTTACAGGCTGGGCA TGG (reversed) Intronic
901260233 1:7865645-7865667 CTCCAAATACAGGCTGAGCATGG + Intergenic
901391701 1:8950272-8950294 CACAGTTTCCAGGCCGGGCATGG - Intronic
901773200 1:11541531-11541553 CTCAACTTCAAGGGTGGGCAAGG - Intergenic
902420678 1:16277432-16277454 TTCCATATCCAGGCTGGGCATGG + Intronic
902452060 1:16502664-16502686 TTCTAGTTACTGGCTGGGCACGG + Intergenic
902559707 1:17269907-17269929 ATACATCTACAGGCTGGGCACGG - Intronic
902601768 1:17544583-17544605 TATAATTTACAGGCTGGGCATGG - Intronic
902947879 1:19855738-19855760 GTTAATTTTTAGGCTGGGCACGG - Intergenic
902953950 1:19911676-19911698 TACAATTTACTGGCCGGGCAGGG - Exonic
903061931 1:20674857-20674879 ATCAATTGACAGGCTGGGCGTGG + Intronic
903087740 1:20878155-20878177 ATTAAATTCCAGGCTGGGCAAGG - Intronic
903338389 1:22639448-22639470 CCCATTTTACAGGCGGAGCATGG - Exonic
903541807 1:24100594-24100616 CTCCATGTCCAGGCCGGGCACGG + Intronic
903880325 1:26503950-26503972 ATAAATTACCAGGCTGGGCACGG + Intergenic
903961399 1:27059972-27059994 AACAATTTCCAGGCCGGGCACGG - Intergenic
904712462 1:32440812-32440834 CAAAAAATACAGGCTGGGCATGG + Intergenic
906067408 1:42991979-42992001 ATCAATTTACAGGCTGGACTTGG - Intergenic
906549006 1:46645882-46645904 AGTAGTTTACAGGCTGGGCATGG + Intronic
906554338 1:46695968-46695990 ATCACTTTGGAGGCTGGGCATGG - Intronic
906630413 1:47362456-47362478 CTCCATCTCCAGGCTGGGCGTGG - Intronic
907104878 1:51873799-51873821 ATAAATTTTCAGGCTGGGCGTGG - Intronic
907215236 1:52858104-52858126 ATTAAGATACAGGCTGGGCATGG + Intronic
907365460 1:53955586-53955608 CTATATTTTCTGGCTGGGCATGG - Intronic
907369818 1:53993589-53993611 ATCAATTTATAGGCCAGGCATGG + Intergenic
907388795 1:54143043-54143065 ATGAATTTACAGGCTGGGCATGG + Intronic
907713228 1:56903878-56903900 CTCAATGTACAGCCTGGGTTGGG + Intronic
908916347 1:69130602-69130624 ATGAATGAACAGGCTGGGCACGG - Intergenic
908955052 1:69614849-69614871 CCAAATTTACAGACTAGGCATGG + Intronic
909147728 1:71958663-71958685 CAAACTTTTCAGGCTGGGCACGG + Intronic
909400747 1:75227063-75227085 AACAAGTTTCAGGCTGGGCACGG + Intronic
909771329 1:79425726-79425748 CTAAATTTAGAGGTTGGGCAAGG + Intergenic
910511129 1:88006228-88006250 CTGAATTTACATGATGGGGAGGG - Intergenic
910712699 1:90198123-90198145 ATCTATTGACAGGCTGGGCTAGG - Intergenic
910992710 1:93072738-93072760 TTGAAATGACAGGCTGGGCATGG + Intergenic
911057267 1:93719630-93719652 TTAAATATAGAGGCTGGGCAGGG - Intronic
911495662 1:98628142-98628164 TTCAACTTATAGGCTGGGCATGG - Intergenic
911956123 1:104237274-104237296 ATGCATTTATAGGCTGGGCACGG + Intergenic
912103838 1:106245501-106245523 ATAAATTTATTGGCTGGGCACGG - Intergenic
912351936 1:109022136-109022158 AAAAATTTTCAGGCTGGGCATGG - Intronic
912379674 1:109240590-109240612 CTCACAGTCCAGGCTGGGCAGGG + Intergenic
913297428 1:117335488-117335510 TTCAGTATTCAGGCTGGGCATGG - Intergenic
913481661 1:119294689-119294711 ATCATTGTACAGGCAGGGCAGGG + Intergenic
913666757 1:121056083-121056105 CTGAATGGACAGGCTGGGCATGG - Intergenic
914018501 1:143843519-143843541 CTGAATGGACAGGCTGGGCATGG - Intergenic
914657056 1:149751722-149751744 CTGAATGGACAGGCTGGGCATGG - Intergenic
914791842 1:150885013-150885035 CTCAGTTTTTAGGCTGGGAACGG - Intergenic
914882063 1:151555035-151555057 CTAAATTTTAAGGCCGGGCATGG + Intronic
915197227 1:154198571-154198593 TTCACTTTACAGGCTGGGTGAGG - Intergenic
915780308 1:158542619-158542641 GTCAATAGAGAGGCTGGGCATGG - Intergenic
916217666 1:162411244-162411266 ATGAAATTCCAGGCTGGGCATGG - Intronic
917825676 1:178818068-178818090 CTGATTTTTCTGGCTGGGCATGG + Intronic
917986926 1:180330119-180330141 CTTCATTTGAAGGCTGGGCATGG + Intronic
918484217 1:185012175-185012197 CTTAATATCAAGGCTGGGCATGG - Intergenic
918748543 1:188240007-188240029 TACAATTTAGGGGCTGGGCATGG - Intergenic
918827509 1:189344797-189344819 ATAATTTTTCAGGCTGGGCATGG + Intergenic
919123871 1:193373330-193373352 CTCAGACTCCAGGCTGGGCATGG - Intergenic
919175358 1:194011701-194011723 CTGGATTTACAGGCCAGGCATGG - Intergenic
919842507 1:201619508-201619530 CTCATTTTGCAGACTGGACATGG + Intergenic
919980476 1:202639882-202639904 CTCAAATTACAGGAGGAGCAGGG - Intronic
920158402 1:203975530-203975552 AAGAATTTTCAGGCTGGGCATGG - Intergenic
920236356 1:204509128-204509150 CTGATTTTTAAGGCTGGGCACGG + Intergenic
920238307 1:204524486-204524508 ATCTATTTTCCGGCTGGGCATGG + Intronic
920888500 1:209957715-209957737 AAAAATCTACAGGCTGGGCAGGG - Intronic
921284187 1:213594153-213594175 TTCCATTTTTAGGCTGGGCATGG - Intergenic
921630243 1:217424240-217424262 CTGAAATATCAGGCTGGGCACGG - Intergenic
921711602 1:218378602-218378624 CAAAATGAACAGGCTGGGCACGG - Intronic
921718218 1:218440538-218440560 ATCTTTCTACAGGCTGGGCACGG - Intronic
922236229 1:223724677-223724699 GTCAATAAACAGGCAGGGCATGG + Intronic
922860943 1:228815791-228815813 CTAAAAATACAGGCTGGGCTTGG - Intergenic
923976053 1:239264593-239264615 GTCAATATACCGGCTGGGCGTGG + Intergenic
924211794 1:241776367-241776389 ATAAATTTTGAGGCTGGGCATGG - Intronic
924281006 1:242437404-242437426 TTTAGTTTACAGGCTGGGCATGG + Intronic
1063101907 10:2957684-2957706 CGCTATTCACAGGCTGGGCAGGG + Intergenic
1063642124 10:7840440-7840462 CTCATTTTCCAGGCCGGGCGCGG - Intronic
1063813099 10:9736956-9736978 TTAAATTAATAGGCTGGGCATGG - Intergenic
1063918160 10:10905450-10905472 CTAAAATTTGAGGCTGGGCATGG + Intergenic
1064454750 10:15476928-15476950 GTCAATAGACAGGCTGGGCTCGG + Intergenic
1064702606 10:18037075-18037097 AGCAATTTTTAGGCTGGGCATGG - Intronic
1064767007 10:18685249-18685271 CTGAATTGTCAGGCTGTGCATGG + Intergenic
1065027930 10:21556251-21556273 CTTAAATTTGAGGCTGGGCACGG - Intronic
1065209021 10:23384900-23384922 AGAAAATTACAGGCTGGGCATGG + Intergenic
1065292761 10:24247504-24247526 ATTAATTTCCAGGCTGGGCGTGG + Intronic
1065356070 10:24843031-24843053 TTAAGTTTTCAGGCTGGGCATGG + Intergenic
1065700314 10:28418873-28418895 ATGAATATACCGGCTGGGCATGG - Intergenic
1065791128 10:29261958-29261980 ATAAATAAACAGGCTGGGCATGG - Intergenic
1066337251 10:34490581-34490603 CTATATTGACAGGCTGGGCGTGG - Intronic
1067302174 10:45021902-45021924 CTCCTTTTATAGGCTGGGCGTGG + Intergenic
1067378330 10:45749120-45749142 CTCTAGTAAAAGGCTGGGCATGG + Intronic
1067460447 10:46454397-46454419 ATTAATTTCCTGGCTGGGCATGG - Intergenic
1067626745 10:47930206-47930228 ATTAATTTCCTGGCTGGGCATGG + Intergenic
1067886028 10:50089795-50089817 CTCTAGTAAAAGGCTGGGCATGG + Intronic
1068097442 10:52509918-52509940 TTTAAGTTACAGGCTGGGCATGG + Intergenic
1068861468 10:61852110-61852132 ATAAATATACAGGCTGGGCATGG - Intergenic
1069104335 10:64364392-64364414 CCTAATTTCCAGGCCGGGCATGG - Intergenic
1069946602 10:71990651-71990673 TTCTTTTTAGAGGCTGGGCATGG - Intronic
1070200863 10:74204751-74204773 GTCAAATTTCAGGCTGGGCGTGG + Intronic
1070316709 10:75320525-75320547 AGCAATATATAGGCTGGGCATGG + Intergenic
1071002906 10:80851239-80851261 AACAGTTTATAGGCTGGGCATGG - Intergenic
1071484521 10:86090035-86090057 TAAAATTTCCAGGCTGGGCACGG - Intronic
1071523272 10:86344078-86344100 CTGATTTAACAAGCTGGGCAAGG - Intronic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1072099951 10:92219865-92219887 GTCAATCTCCAGGCCGGGCATGG + Intronic
1072231766 10:93419839-93419861 TTTAATTTTAAGGCTGGGCATGG + Intronic
1072315219 10:94196053-94196075 CTCATTTGACAGGCTGGCAAAGG - Intronic
1074258711 10:111830351-111830373 CTCAATTTCCAGACTATGCAAGG + Intergenic
1074505605 10:114067721-114067743 CTCAAAAAAAAGGCTGGGCATGG - Intergenic
1074799110 10:116981026-116981048 TTACATTTACAGGCTGGGCGTGG + Intronic
1075203476 10:120426129-120426151 CACATTTTAAAGGCAGGGCATGG + Intergenic
1075558449 10:123449879-123449901 CTCACTTTAGAAGCTGGGGAAGG + Intergenic
1075966277 10:126614515-126614537 CTCAATCCACAGGCAGGGGAAGG - Intronic
1076051338 10:127336004-127336026 AAAAAATTACAGGCTGGGCATGG - Intronic
1076271982 10:129161684-129161706 CTAAAAACACAGGCTGGGCACGG + Intergenic
1077630064 11:3805576-3805598 TCAATTTTACAGGCTGGGCACGG + Intronic
1078187081 11:9061245-9061267 CTCACTTTAAAGGCTGGGGGTGG + Intronic
1078691985 11:13590941-13590963 TTCAATATCCAGGCTGGGCACGG + Intergenic
1078772850 11:14366684-14366706 TCCAGTTTAAAGGCTGGGCATGG + Intergenic
1078791235 11:14544322-14544344 ATTAATTTACCGGCCGGGCACGG - Intronic
1078978352 11:16503752-16503774 CTAAATTTATCGGTTGGGCACGG + Intronic
1079423579 11:20317983-20318005 CTGATGTTTCAGGCTGGGCATGG + Intergenic
1079578852 11:22037083-22037105 CTCAATTTCCAGGAATGGCAAGG + Intergenic
1079764311 11:24371550-24371572 CACATATTACAGGCTGGGCATGG - Intergenic
1080166088 11:29239383-29239405 ATATATTTAAAGGCTGGGCACGG + Intergenic
1080324676 11:31056939-31056961 AACAAATTTCAGGCTGGGCACGG + Intronic
1080815421 11:35751823-35751845 TACAATTTACAGGATGTGCACGG + Intronic
1081123857 11:39299173-39299195 CTAATTGTATAGGCTGGGCATGG + Intergenic
1081525231 11:43923699-43923721 CTCTATTCACAGGCTGGGGAAGG - Intergenic
1081615523 11:44588510-44588532 CTTATTTTGCAGGCTGGGTACGG - Intronic
1082207792 11:49459238-49459260 GTCAATAAAGAGGCTGGGCACGG + Intergenic
1082280215 11:50263541-50263563 GTAATTTTATAGGCTGGGCATGG + Intergenic
1083325768 11:61872244-61872266 CCCTAGTCACAGGCTGGGCAGGG + Intergenic
1083365788 11:62140804-62140826 CTCACCTTGCTGGCTGGGCAGGG - Exonic
1083843495 11:65317421-65317443 CTCAGTTTTCATTCTGGGCAGGG - Intronic
1084065663 11:66702646-66702668 CTTTATTTACAGACCGGGCATGG + Intronic
1084104489 11:66972312-66972334 CCCATTTTACAGGCTGGGTGCGG + Intergenic
1085102996 11:73817120-73817142 CAAAATAAACAGGCTGGGCATGG - Intronic
1085111406 11:73892948-73892970 AGCAAGTTATAGGCTGGGCACGG - Intronic
1085187593 11:74589556-74589578 ATAAATAAACAGGCTGGGCACGG + Intronic
1085290372 11:75394849-75394871 CTGAATCCAAAGGCTGGGCATGG - Intergenic
1085459197 11:76682991-76683013 CTCATTTTAGAGAGTGGGCATGG + Intergenic
1085499707 11:77008763-77008785 ATAAAATTCCAGGCTGGGCATGG + Intronic
1085571361 11:77560686-77560708 CTGAAATGATAGGCTGGGCATGG - Intronic
1086204301 11:84239470-84239492 TTTAAATTCCAGGCTGGGCATGG - Intronic
1088285592 11:108184180-108184202 CTCATTTTATTGGCCGGGCACGG + Intronic
1088474685 11:110223058-110223080 CACAAATTTTAGGCTGGGCACGG + Intronic
1089133901 11:116234192-116234214 CTCAATTAATAAGCTGCGCATGG - Intergenic
1089570796 11:119407785-119407807 ATAATTATACAGGCTGGGCATGG - Intergenic
1089995846 11:122906483-122906505 AACATTTTTCAGGCTGGGCATGG - Intronic
1090085910 11:123650930-123650952 TTTATTTTAAAGGCTGGGCATGG + Intronic
1090383229 11:126341461-126341483 GTCAGTTCACAGGCTGGGTAAGG - Intronic
1090552754 11:127841014-127841036 GTGAAATTTCAGGCTGGGCACGG - Intergenic
1091447905 12:554498-554520 GTATATTTACAGGCTGGGCGCGG + Intronic
1092382521 12:8009151-8009173 CTTAACTTATTGGCTGGGCATGG + Intergenic
1092789110 12:12056537-12056559 CACAGTTAATAGGCTGGGCACGG + Intronic
1092906925 12:13109296-13109318 ATCAATGCACAGGCTGGGCGTGG - Intronic
1094537558 12:31335600-31335622 AGCAATTTGCAGGCAGGGCACGG + Intergenic
1095450685 12:42327389-42327411 CTGCATTTAAAGGTTGGGCATGG + Intronic
1096270212 12:50159879-50159901 TTTAAATTACAGGCTGGGCACGG - Intronic
1096288432 12:50320587-50320609 CTCAAGTTACTGGCTGGGTGCGG - Intergenic
1097109651 12:56648974-56648996 ATAATTTTACAGGCTGGGCATGG + Intergenic
1097172168 12:57122115-57122137 CACAATTAACAGGCCAGGCATGG - Intronic
1097789083 12:63795003-63795025 ATCAAAATATAGGCTGGGCATGG + Intronic
1098233515 12:68396611-68396633 CTCAGTTCTCAGGCCGGGCACGG + Intergenic
1098876439 12:75870564-75870586 TTCAAATAGCAGGCTGGGCATGG - Intergenic
1101002736 12:100372853-100372875 ATCCATTTACTGGCTGGGCGTGG - Intronic
1101173873 12:102128519-102128541 TTGAACTTACAGGCCGGGCACGG - Intronic
1101888307 12:108688743-108688765 CTAAAAATACAGGCCGGGCACGG + Intronic
1102098281 12:110257727-110257749 CTGAATGTCCAGGCTGGGCGAGG - Intergenic
1102102985 12:110295107-110295129 ATCAATGAAAAGGCTGGGCATGG - Intronic
1102281226 12:111620521-111620543 CTCAATGGGAAGGCTGGGCATGG - Intergenic
1102476796 12:113193945-113193967 CTCTCTTTCCTGGCTGGGCATGG + Intergenic
1102928526 12:116844950-116844972 CTCAATCCAGTGGCTGGGCATGG + Intronic
1102984145 12:117264991-117265013 TTTAATTAGCAGGCTGGGCATGG - Intronic
1103005781 12:117419016-117419038 ATGAATGTACAGTCTGGGCATGG - Intronic
1103148323 12:118614837-118614859 AAAAAATTACAGGCTGGGCACGG + Intergenic
1103371045 12:120419745-120419767 CTAAAAATACAGGCTGGGCGCGG + Intergenic
1104703138 12:130922400-130922422 CTCAATTAACAGGCGGTGGAGGG + Intergenic
1105329721 13:19404279-19404301 ATTAATTCCCAGGCTGGGCATGG - Intergenic
1105388341 13:19953392-19953414 TTCAACCTATAGGCTGGGCACGG + Intergenic
1105389794 13:19964553-19964575 CCCAACCTACTGGCTGGGCATGG - Intronic
1105548787 13:21372077-21372099 ATCAAATTGCAGGCCGGGCACGG - Intergenic
1105859099 13:24393945-24393967 TTCAAGTTACAGTCTGAGCATGG - Intergenic
1106159770 13:27190340-27190362 TTCTATTTACAGGCTGGGTGTGG - Intergenic
1106278020 13:28233555-28233577 CTTAATTTCCAGGCCGGTCATGG - Intronic
1108005776 13:45944834-45944856 TTCCATATACGGGCTGGGCACGG - Intergenic
1108417239 13:50210559-50210581 CACCATATCCAGGCTGGGCATGG - Intronic
1109487708 13:63050093-63050115 ATAATTCTACAGGCTGGGCACGG + Intergenic
1110445352 13:75573925-75573947 GTCACTTTTCAGGCTGGGCGCGG + Intronic
1111872152 13:93846520-93846542 TGAAATTTTCAGGCTGGGCACGG + Intronic
1112207969 13:97344094-97344116 CTAAATTTACGGGCTGGGCGCGG - Intronic
1112355447 13:98671269-98671291 CTCAAAGTAGAGGCTGGGCACGG + Intergenic
1112547299 13:100383280-100383302 TTGAAATCACAGGCTGGGCACGG - Intronic
1112680869 13:101763566-101763588 CTTAACTTCCTGGCTGGGCATGG + Intronic
1113352479 13:109542815-109542837 ATGAAATTACAGGCTGGGCATGG - Intergenic
1113370950 13:109725023-109725045 CTGCATTCACAGGCTGGGCTGGG + Intergenic
1113850863 13:113417228-113417250 CCCAATCTGCAGGCTGGTCATGG + Intergenic
1114449251 14:22814078-22814100 TTCAAGTTGGAGGCTGGGCAAGG - Intronic
1114469975 14:22953918-22953940 CAAAAATTAGAGGCTGGGCACGG - Intronic
1114641413 14:24224352-24224374 AACAATTTTCAGGCCGGGCATGG - Intronic
1114651215 14:24285691-24285713 ATAAATTAACAGGCTGGGCACGG + Intergenic
1114708100 14:24747961-24747983 ATTGATTTACAGGCTGGGCGTGG + Intergenic
1114815632 14:25954615-25954637 AGCAAATTTCAGGCTGGGCATGG - Intergenic
1115226741 14:31110919-31110941 TTCTGTTTTCAGGCTGGGCACGG - Intronic
1115505689 14:34092353-34092375 CTCCATTCTCAGGCTGCGCATGG + Intronic
1115596036 14:34909913-34909935 ATAAAAATACAGGCTGGGCATGG + Intergenic
1115686171 14:35798465-35798487 CTTCTCTTACAGGCTGGGCATGG - Intronic
1116010563 14:39346894-39346916 CTGACTTTCCAGGCTGAGCAAGG - Intronic
1116133911 14:40896356-40896378 AAAAATATACAGGCTGGGCACGG + Intergenic
1116722990 14:48524649-48524671 TAAAATATACAGGCTGGGCATGG - Intergenic
1116746854 14:48831074-48831096 TACAATGTACAGGCTAGGCACGG + Intergenic
1116899340 14:50346937-50346959 CTTAATTTGCAGGCCGGGCATGG - Intronic
1117089717 14:52237609-52237631 TTCAGTGTTCAGGCTGGGCATGG - Intergenic
1117168714 14:53067750-53067772 TTCAAATAAGAGGCTGGGCAGGG - Intronic
1117554825 14:56873123-56873145 CCCATGTTCCAGGCTGGGCATGG - Intergenic
1117855994 14:60034305-60034327 AAAAATTTACAGGCTGAGCACGG - Intronic
1117925724 14:60777138-60777160 CACTATTCAAAGGCTGGGCATGG - Intronic
1118408784 14:65454334-65454356 AGCATTATACAGGCTGGGCATGG + Intronic
1118520108 14:66573743-66573765 GTCATTATATAGGCTGGGCATGG - Intronic
1119282937 14:73426098-73426120 TTAAAATTAGAGGCTGGGCACGG - Intronic
1119366043 14:74092624-74092646 CTACATTTATAGGCTGGGCATGG + Intronic
1119822766 14:77632534-77632556 GTGGTTTTACAGGCTGGGCATGG - Intergenic
1120547271 14:85827315-85827337 CCACATTTACAGGGTGGGCAGGG + Intergenic
1120554934 14:85918187-85918209 CTCATTTTACATGTTGGGGAAGG + Intergenic
1120988955 14:90358147-90358169 CTGCCTGTACAGGCTGGGCATGG - Intergenic
1121171950 14:91862045-91862067 TTTAAATTATAGGCTGGGCATGG + Intronic
1121909331 14:97775033-97775055 AGCATTTTACAGGCTGGGCACGG + Intergenic
1122414768 14:101543623-101543645 CTCAATTTACCAGCTGTGAAAGG + Intergenic
1122680286 14:103455434-103455456 ATCATTATGCAGGCTGGGCACGG + Intronic
1124506743 15:30283564-30283586 CTGAATTAATAGGCTGGGCGCGG + Intergenic
1124555055 15:30717759-30717781 GTGACTTTACAGGCTGGACATGG - Intronic
1124736814 15:32255070-32255092 CTGAATTAATAGGCTGGGCGCGG - Intergenic
1124836092 15:33197353-33197375 CTCCACTAACAAGCTGGGCATGG - Intergenic
1124870318 15:33534889-33534911 CTCCATTTAGAGGTTGGGCTAGG + Intronic
1124988023 15:34641948-34641970 ATGATTTTACTGGCTGGGCACGG - Intergenic
1125033382 15:35095371-35095393 CTCACTTTCTGGGCTGGGCACGG + Intergenic
1125587303 15:40829871-40829893 AAAAAATTACAGGCTGGGCACGG - Intergenic
1126842976 15:52735008-52735030 ATAAATTTGGAGGCTGGGCATGG + Intergenic
1126864802 15:52925038-52925060 CTCAATATCGAGGCTTGGCAAGG + Intergenic
1127747172 15:61990518-61990540 CTAAAGTTGGAGGCTGGGCACGG + Intronic
1127940948 15:63695325-63695347 TTAAATTTGGAGGCTGGGCATGG - Intronic
1128290371 15:66473970-66473992 CTAAATTTTTAGGCCGGGCATGG - Intronic
1129386145 15:75197117-75197139 CTCAGCTCAGAGGCTGGGCACGG - Intronic
1129422952 15:75444172-75444194 ATAAATTTTCAGGCTGGGCATGG + Intronic
1129632892 15:77280866-77280888 TTCTATTTCCTGGCTGGGCATGG + Intronic
1129675110 15:77628732-77628754 ATTAATTAACAGGCTGGGCCTGG + Intronic
1129995526 15:80001949-80001971 AACCATTTACGGGCTGGGCACGG + Intergenic
1130007759 15:80117510-80117532 CTGAGTATTCAGGCTGGGCACGG - Intronic
1130455838 15:84106281-84106303 CTCACTTTGATGGCTGGGCACGG - Intergenic
1130824404 15:87529519-87529541 GTCAATCTGAAGGCTGGGCATGG + Intergenic
1131142200 15:89986279-89986301 ATCAATTGGCAGGTTGGGCATGG + Intergenic
1131694564 15:94861758-94861780 GTAAAATGACAGGCTGGGCACGG - Intergenic
1131817359 15:96235291-96235313 CTTACTAAACAGGCTGGGCACGG - Intergenic
1131858668 15:96627473-96627495 CTGAACTGACAGGCTGGGCCTGG + Intergenic
1132213504 15:100045095-100045117 CCAAATTAACAGGCTGGGCATGG - Intronic
1132316741 15:100895715-100895737 CCCAGTGTGCAGGCTGGGCAAGG - Intronic
1132526524 16:418676-418698 CTAAATATACAGGCCGGGCGCGG - Intergenic
1132796501 16:1726377-1726399 CTCAAATTACAGGCAAGGCTGGG + Intronic
1132919869 16:2381776-2381798 GTGAGTATACAGGCTGGGCACGG - Intergenic
1133390974 16:5409754-5409776 ATCAACATGCAGGCTGGGCATGG + Intergenic
1133558257 16:6926016-6926038 CTCAACTTGCTGGCTGGGCTTGG + Intronic
1134110404 16:11511996-11512018 CTTAAGTTGAAGGCTGGGCACGG + Intronic
1134169887 16:11960063-11960085 CACAAAGTACAGACTGGGCACGG - Intronic
1134631971 16:15762900-15762922 CACAATATACAGCCTGGGCTGGG + Intronic
1134675109 16:16084909-16084931 CTCAAGTTATAGGCCGGGCGAGG - Intronic
1134693973 16:16209372-16209394 ATCAATTTACAGGCTGGGTGTGG - Intronic
1134829239 16:17309986-17310008 CTCAATTTGGAGGCTGGGAGTGG + Intronic
1135112500 16:19701554-19701576 ATCAATTTATTGGCCGGGCACGG + Intronic
1135139491 16:19909312-19909334 CTCACTTCTCAGGGTGGGCAAGG + Intergenic
1135292069 16:21248437-21248459 ATAAAATTACAGGCTGGGCGTGG + Intronic
1136132199 16:28230153-28230175 TTAAAGATACAGGCTGGGCACGG - Intergenic
1136178009 16:28531832-28531854 ATCAATTTTGGGGCTGGGCACGG + Intergenic
1136353264 16:29726115-29726137 CTCAAAATATAGGCTGGGCGTGG - Intergenic
1137265554 16:46866341-46866363 TTTATTTTAAAGGCTGGGCATGG + Intergenic
1137331177 16:47498385-47498407 ATCAATTTAGAGGCTGGGCATGG + Intronic
1137381695 16:48005315-48005337 AAAAAATTACAGGCTGGGCACGG + Intergenic
1138154583 16:54691523-54691545 ATGAATTTACAGGCTATGCAAGG - Intergenic
1138387172 16:56643618-56643640 CTGACTTTACAGTCAGGGCAGGG - Intronic
1138732276 16:59208485-59208507 AAGAATTCACAGGCTGGGCATGG + Intergenic
1139395703 16:66637252-66637274 ATAAATTTCTAGGCTGGGCACGG + Intronic
1139423582 16:66864832-66864854 TTGTATTTATAGGCTGGGCACGG + Intronic
1139509296 16:67417295-67417317 CTGAATTTCCCGGCCGGGCAGGG - Intergenic
1139772995 16:69294431-69294453 AGGATTTTACAGGCTGGGCATGG + Intronic
1139936415 16:70574781-70574803 CAGAATTTAGAGGCTGGGCATGG - Exonic
1140042027 16:71414384-71414406 CTTAAGGTCCAGGCTGGGCACGG + Intergenic
1140383403 16:74511359-74511381 CTGAGTTTTTAGGCTGGGCATGG + Intronic
1141578896 16:84983709-84983731 AACATTTTACTGGCTGGGCAGGG + Intronic
1141600295 16:85121830-85121852 AACAATTTAGGGGCTGGGCACGG + Intergenic
1141934877 16:87230864-87230886 CACATTTTTAAGGCTGGGCAGGG + Intronic
1142350838 16:89578998-89579020 TAAAATTTACAGGCCGGGCACGG + Intronic
1142548082 17:719651-719673 AACAACTTCCAGGCTGGGCACGG + Intronic
1142686314 17:1578848-1578870 ATTAAATTATAGGCTGGGCAAGG + Intronic
1142707435 17:1704990-1705012 TTAAATATCCAGGCTGGGCATGG - Exonic
1143191794 17:5045263-5045285 AAAAATTTACTGGCTGGGCATGG + Intronic
1143393875 17:6576567-6576589 CTGAATTTACAGGCTCTGCAGGG + Intergenic
1143703127 17:8676204-8676226 ATCAAATTACAGGCCAGGCATGG - Intergenic
1144451258 17:15381176-15381198 CTCAAGATTCAGGCAGGGCACGG - Intergenic
1144470868 17:15539801-15539823 TACAACATACAGGCTGGGCACGG + Intronic
1144550768 17:16239031-16239053 CTAAATTTTCAGGTCGGGCAAGG - Intronic
1144925601 17:18804876-18804898 TACAACATACAGGCTGGGCACGG - Intronic
1145215793 17:21051349-21051371 TTCTATTTTCTGGCTGGGCATGG - Intergenic
1145807181 17:27743048-27743070 CTCATTTTTCAGGCCAGGCATGG + Intergenic
1145914586 17:28564275-28564297 CAAAATACACAGGCTGGGCACGG + Intronic
1146101012 17:29982141-29982163 TTCAGTTTAGCGGCTGGGCACGG + Intronic
1146259275 17:31411071-31411093 CTCACTTTCCAGGCCGGGCGCGG + Intronic
1146814063 17:35928470-35928492 CTAAATATATAGGCTGGGCGCGG + Intronic
1146904374 17:36608676-36608698 CTCAACTTCCAGGCAGGGCCTGG - Exonic
1147713199 17:42485138-42485160 TGGAAGTTACAGGCTGGGCACGG - Intronic
1147812877 17:43185704-43185726 ATAAATTTCTAGGCTGGGCACGG + Intronic
1147921291 17:43918594-43918616 CTGAATTTCCTGGCTGGGCGTGG + Intergenic
1148090669 17:45020875-45020897 CCCAGCTTACAGGCTGGGAACGG - Intergenic
1148237488 17:45978676-45978698 CTCAACTCCCAGGCTGGACAAGG - Intronic
1148254322 17:46115348-46115370 CTTGCTTTACAGGCTGGACACGG - Intronic
1148382659 17:47210858-47210880 CTCCATTTACAAGCTGAGCCTGG + Intronic
1148622409 17:49044279-49044301 CTGGGTTTTCAGGCTGGGCAGGG + Intronic
1148883815 17:50756613-50756635 CTCAATTTGAAGACTGGGCGCGG - Intergenic
1149280583 17:55100984-55101006 TTCAATCTACAGGTTGAGCATGG - Intronic
1149510320 17:57235919-57235941 ATCTATTTCCAGGCTGGGCATGG + Intergenic
1149680338 17:58502446-58502468 TGTAAATTACAGGCTGGGCACGG - Intronic
1149708838 17:58720121-58720143 CTAAAATCACAGGCTGGGCGCGG + Intronic
1149970831 17:61216830-61216852 ATCAACATATAGGCTGGGCACGG - Intronic
1150109889 17:62489631-62489653 GAAAATATACAGGCTGGGCATGG - Intronic
1150333087 17:64310125-64310147 ATCACATTATAGGCTGGGCATGG + Intergenic
1150575256 17:66425050-66425072 AACAGTATACAGGCTGGGCACGG - Intronic
1150949275 17:69784222-69784244 ATAAATTAAGAGGCTGGGCACGG + Intergenic
1151132138 17:71908155-71908177 CTCAGTAACCAGGCTGGGCATGG + Intergenic
1151284488 17:73100090-73100112 CAAAAAATACAGGCTGGGCACGG + Intergenic
1152833646 17:82515269-82515291 AAAAATTTACAGGCTGGGCACGG + Intergenic
1153213619 18:2795347-2795369 CAGAATTTTTAGGCTGGGCATGG - Intronic
1153602836 18:6798483-6798505 AATAATTTACAGGCTGGGCATGG - Intronic
1153611878 18:6894155-6894177 CACAATATAGTGGCTGGGCATGG - Intronic
1153989318 18:10381915-10381937 CACCATTCACAGGCTGGCCATGG + Intergenic
1156393688 18:36677437-36677459 AACAAAATACAGGCTGGGCATGG - Intronic
1156394165 18:36682867-36682889 CACAAGTTATTGGCTGGGCATGG - Intronic
1157054615 18:44212006-44212028 CTCAACATCCTGGCTGGGCACGG + Intergenic
1157255384 18:46134125-46134147 ATCAATTTGGGGGCTGGGCATGG + Intergenic
1157615634 18:48986122-48986144 CCGTATTTACAGGCTGGGCACGG - Intergenic
1157901366 18:51521550-51521572 CTCAATTTAGAAGCTGGTAAGGG + Intergenic
1158003503 18:52646143-52646165 CTCAGTTTCCTGACTGGGCACGG + Intronic
1158124652 18:54087819-54087841 CTCAAACAACAGGCTGGGGATGG + Intergenic
1158458178 18:57625446-57625468 CTGAATTTACTGGCCAGGCACGG + Intergenic
1158611989 18:58949406-58949428 TACATTATACAGGCTGGGCACGG + Intronic
1158704955 18:59784031-59784053 TTAAATTTCCTGGCTGGGCACGG + Intergenic
1159009765 18:63047538-63047560 AACAAATCACAGGCTGGGCATGG - Intergenic
1159519993 18:69507315-69507337 CTATAATTACCGGCTGGGCACGG - Intronic
1159556499 18:69951266-69951288 CATAGTTTTCAGGCTGGGCATGG - Intronic
1159734258 18:72074709-72074731 CTCAAGTATTAGGCTGGGCACGG + Intergenic
1159764561 18:72472601-72472623 AACAATTTTCTGGCTGGGCATGG + Intergenic
1160670890 19:362475-362497 CTCCACATTCAGGCTGGGCATGG + Intronic
1160705910 19:530235-530257 ATCAACATACAGGCCGGGCACGG - Intergenic
1160735596 19:661038-661060 CAGAATTTACAGGCTGGCCAGGG - Intronic
1161018499 19:1995943-1995965 ATCAAAGTCCAGGCTGGGCACGG - Intronic
1161200885 19:3014208-3014230 CCCATTTTACAGGCCGGGCGTGG - Intronic
1162161172 19:8718350-8718372 TGAAATTCACAGGCTGGGCATGG - Intergenic
1162609022 19:11734982-11735004 AGCAATTTTCTGGCTGGGCATGG + Intronic
1162634343 19:11955290-11955312 AAGAATTTTCAGGCTGGGCACGG - Intronic
1162897147 19:13771698-13771720 CTAAAAATACTGGCTGGGCATGG + Intronic
1163135339 19:15307065-15307087 CTCAAAATTCAGGATGGGCAAGG + Intronic
1163452529 19:17386880-17386902 CTAAATGAATAGGCTGGGCACGG - Intergenic
1163517533 19:17774197-17774219 CTCAATTGAGGGGCTGGGCACGG - Intronic
1163665430 19:18601563-18601585 CTAAAAATACAGGCTGGGCGCGG - Intronic
1163857933 19:19720631-19720653 CCCAATTTCCTGGCAGGGCATGG - Intronic
1164466773 19:28493789-28493811 CTCAATTTTTTGGCCGGGCATGG - Intergenic
1164618496 19:29680510-29680532 TTCAAAGAACAGGCTGGGCAGGG - Intergenic
1164747905 19:30629484-30629506 GGCAATTATCAGGCTGGGCATGG - Intronic
1165206085 19:34187578-34187600 AACATTTTCCAGGCTGGGCATGG - Intronic
1165565385 19:36722588-36722610 AACAATTTTCAGGCTGGGCACGG - Intronic
1165686719 19:37828277-37828299 ATCAATGCACAGGCTGGGCGTGG - Intergenic
1165738238 19:38191114-38191136 ATGAATTTATAAGCTGGGCATGG + Intronic
1166053787 19:40276652-40276674 TCCATTCTACAGGCTGGGCACGG - Intronic
1166755194 19:45186434-45186456 CTGGGATTACAGGCTGGGCATGG - Intronic
1166771134 19:45283117-45283139 ATCAACTTCCAGGCAGGGCATGG + Intronic
1166845891 19:45728214-45728236 CTCAATCTGTGGGCTGGGCATGG - Intronic
1166854051 19:45773931-45773953 ACTAATTTACAGGCTGGGCATGG - Intronic
1167352908 19:48986785-48986807 CTTAGTTTCCAGGCTGGGCACGG - Intronic
1167527987 19:49997271-49997293 TTAAATTTTCAGGCTGGGCGTGG - Intronic
1168034580 19:53709314-53709336 ATAAAATAACAGGCTGGGCACGG - Intergenic
1168144763 19:54414812-54414834 GTCAGTTTACAGGATGGGAAGGG + Intergenic
1168189891 19:54730261-54730283 ATACATTTATAGGCTGGGCACGG + Intronic
1168199197 19:54802024-54802046 GTCAATGTACAGGCTGGGTGTGG - Intronic
1168373122 19:55852765-55852787 CAATATTTTCAGGCTGGGCATGG - Intronic
1168396021 19:56049469-56049491 CTAAAAATACAGGCTGGGCACGG - Intronic
925628156 2:5862680-5862702 CTCCATCCACAGGCTGAGCACGG + Intergenic
925803328 2:7624327-7624349 CTCAAATTTCTGGCTGGACATGG - Intergenic
925958391 2:8992425-8992447 CTCAATGGAGAGGCTGGGCACGG - Intronic
926011976 2:9415820-9415842 CTCAGTTTCCAGTCAGGGCAGGG - Intronic
926388238 2:12360020-12360042 CTTATTGTTCAGGCTGGGCATGG + Intergenic
926613311 2:14969665-14969687 AATAACTTACAGGCTGGGCAAGG - Intergenic
927537684 2:23877134-23877156 TTTTTTTTACAGGCTGGGCAGGG + Intronic
928568988 2:32584020-32584042 TGAAATTTACAGGCCGGGCAAGG - Intronic
929042175 2:37755709-37755731 CTCATAAAACAGGCTGGGCATGG + Intergenic
929053488 2:37857045-37857067 ATTAATTAACAGGCTGAGCACGG + Intergenic
929101915 2:38323492-38323514 CTTAAACTTCAGGCTGGGCATGG - Intronic
929455884 2:42065203-42065225 ATAAATTTGGAGGCTGGGCACGG + Intergenic
929577226 2:43059537-43059559 CTGAATCTACAGTTTGGGCAGGG + Intergenic
929809776 2:45179990-45180012 GTCAAAATACTGGCTGGGCATGG - Intergenic
930339102 2:50089494-50089516 CACATTTTTTAGGCTGGGCATGG + Intronic
930662549 2:54069370-54069392 AGCAAAATACAGGCTGGGCACGG + Intronic
930809324 2:55524554-55524576 ATTAGTTTACAGGCTGGGCGTGG - Intronic
931019087 2:58022305-58022327 CTCAATTCACAGGCTGTTCCTGG - Intronic
931142091 2:59472300-59472322 GTAAATATACAGGCTGGGCATGG + Intergenic
931252655 2:60547760-60547782 CTCAATATTCAGCCTGGGTAGGG - Intronic
931508013 2:62953393-62953415 ATCAAGTTTTAGGCTGGGCATGG + Intronic
931723510 2:65085516-65085538 CTCAAGCTGAAGGCTGGGCACGG + Exonic
932785156 2:74594581-74594603 GTAAATTTACAGGCTGGGCATGG + Intronic
933621971 2:84553758-84553780 TGGTATTTACAGGCTGGGCATGG - Intronic
933795024 2:85912724-85912746 CTCTAGATACTGGCTGGGCACGG + Intergenic
933822041 2:86121992-86122014 CTCAACTTACAGGCGGGCCCCGG - Intronic
933919977 2:87035748-87035770 AACAATTTTTAGGCTGGGCACGG + Intergenic
934003018 2:87734146-87734168 AACAATTTTTAGGCTGGGCACGG - Intergenic
934848926 2:97684323-97684345 ATCAATTGACTGGCCGGGCACGG - Intergenic
935069888 2:99684765-99684787 CTGAATTCATGGGCTGGGCACGG - Intronic
935183544 2:100711295-100711317 CCCAATCTTCAGGCCGGGCATGG - Intergenic
936109000 2:109649686-109649708 TTCAAAATACTGGCTGGGCATGG - Intergenic
936286442 2:111184929-111184951 CTCACTTTTCAGGTTAGGCATGG - Intergenic
936467837 2:112769336-112769358 ATCAAAATACAGGCTGGGTACGG + Intergenic
937922753 2:127143482-127143504 ATCAATTCACAGGCTGGAAACGG + Intergenic
938021313 2:127908001-127908023 AACAATATCCAGGCTGGGCATGG + Intergenic
938076928 2:128344879-128344901 CTCCATTATAAGGCTGGGCACGG - Intergenic
938115435 2:128600023-128600045 ATCAATGTAGAGCCTGGGCATGG - Intergenic
938906234 2:135838681-135838703 CCTTATATACAGGCTGGGCATGG + Intergenic
939160631 2:138584424-138584446 CTGCATTCACAGGCTGGGCGCGG - Intergenic
939346385 2:140971032-140971054 ATCATTTTAGAGGCTGAGCACGG - Intronic
939458206 2:142465124-142465146 AACATTCTACAGGCTGGGCACGG - Intergenic
940488696 2:154329391-154329413 ATAAAATTTCAGGCTGGGCATGG - Intronic
941255540 2:163226679-163226701 ATCATTTCTCAGGCTGGGCACGG + Intergenic
941692455 2:168515317-168515339 CTTAATTTACATGCCGGGCTTGG - Intronic
941727055 2:168872256-168872278 TTCTTTTTTCAGGCTGGGCATGG - Intronic
941914043 2:170796725-170796747 CACAATTGTGAGGCTGGGCATGG - Intronic
941989025 2:171536594-171536616 CTAAAAATACAGGCTGGGCGTGG - Intronic
941999606 2:171632822-171632844 GTGAATTTTCTGGCTGGGCATGG + Intergenic
942639310 2:178044617-178044639 CTCAGTTTGGGGGCTGGGCAGGG - Intronic
944248954 2:197561725-197561747 CTTCATTTACAGGCTGGGTGTGG - Intergenic
944399625 2:199310419-199310441 CTCAATTGAAAGGCAGGTCATGG + Intronic
944726904 2:202480661-202480683 ATCAATTGACAGGCCGGGCACGG + Intronic
944824409 2:203467298-203467320 TTCCCTATACAGGCTGGGCATGG + Intronic
945008121 2:205431365-205431387 ATCAAGTTTCGGGCTGGGCATGG - Intronic
945086043 2:206133685-206133707 GTAAAGTTATAGGCTGGGCACGG + Intronic
945264194 2:207874282-207874304 CTGTATTTTCAGGCCGGGCATGG + Intronic
945493850 2:210486212-210486234 CCCAATTTAAAAGCTGGGAATGG - Intronic
945608911 2:211973489-211973511 TTTAATTTCCCGGCTGGGCACGG - Intronic
945724088 2:213453738-213453760 CTCTATTTTGAGGCTGGGCCAGG - Intronic
946261975 2:218500535-218500557 TTAAAAATACAGGCTGGGCACGG - Intronic
946756343 2:222951649-222951671 AACATTATACAGGCTGGGCATGG + Intergenic
946862043 2:224009402-224009424 ATAAATGTACAGGCCGGGCACGG + Intronic
947791057 2:232869635-232869657 ATCCATTTCCAGGCTGGGCCTGG - Exonic
947835973 2:233175970-233175992 TTCTATTTTCAGGCTGGGCATGG - Intronic
948755138 2:240155131-240155153 CTCAATTAGGAGGCTTGGCAAGG - Intergenic
948888740 2:240896770-240896792 CTCAGGTTGGAGGCTGGGCAGGG - Intronic
1169485506 20:6027703-6027725 TTCAATTTCCAGGCTGGGCGGGG - Intronic
1170453679 20:16512261-16512283 CTCATTTTATAGGTTAGGCAAGG + Intronic
1170573276 20:17644579-17644601 CTGTAGTTACAGACTGGGCAGGG + Intronic
1170672889 20:18451440-18451462 CTCAACTTAGAGGTTGAGCAGGG - Intronic
1171345174 20:24460360-24460382 TTCTGTTTTCAGGCTGGGCATGG + Intergenic
1172261260 20:33567872-33567894 TTTAATTTACAGGCTGGGCGTGG - Intronic
1172378931 20:34472083-34472105 GTTAATTTACTCGCTGGGCACGG + Intronic
1172403662 20:34671550-34671572 AGAAATTAACAGGCTGGGCACGG - Intronic
1172423376 20:34836643-34836665 TTTTATTGACAGGCTGGGCACGG + Intergenic
1172678163 20:36690008-36690030 TTCCAATTACAGGCTGGGCGCGG - Intronic
1173594879 20:44252347-44252369 CTAAAAATACAGGCTGGGCGTGG + Intronic
1174027989 20:47595080-47595102 GTCATTTTAAAGGCTGGGCGTGG - Intronic
1174484538 20:50852883-50852905 CTCAAATGCCAGGCTGGGCAGGG - Intronic
1174583951 20:51592984-51593006 ATCCATTGACTGGCTGGGCACGG + Intergenic
1174612884 20:51813650-51813672 CTTAATTGTCAGGCTGGGCATGG + Intergenic
1174620849 20:51873508-51873530 CTAAAAATACAGGCTGGGCACGG - Intergenic
1175177616 20:57122099-57122121 CACATTTTGCAGGCTGGGCATGG - Intergenic
1175833112 20:61977965-61977987 CTCAATTTAAAGGCTGCCGAGGG + Intronic
1176225569 20:63996603-63996625 AACAAATTTCAGGCTGGGCATGG - Intronic
1176649795 21:9534951-9534973 TAAATTTTACAGGCTGGGCATGG - Intergenic
1176677520 21:9793372-9793394 AACAATTTACCAGCTGGGCATGG + Intergenic
1177035030 21:16032514-16032536 ATAAAGTTTCAGGCTGGGCACGG + Intergenic
1177646703 21:23907792-23907814 GTCAATTTACAGGCCGGGTGCGG - Intergenic
1177970313 21:27780416-27780438 GTCATTTTACAGGCCAGGCATGG - Intergenic
1178130430 21:29565722-29565744 CTCACTATACCGGCTGGGCATGG - Intronic
1178176563 21:30106259-30106281 GTTATTTTATAGGCTGGGCACGG - Intergenic
1178187248 21:30236889-30236911 AACAATTTAGGGGCTGGGCATGG - Intergenic
1178338438 21:31764894-31764916 TTCAAGGTAGAGGCTGGGCATGG - Intergenic
1178483610 21:33002868-33002890 TTCAAATTATTGGCTGGGCACGG - Intergenic
1178539625 21:33438505-33438527 ATCCATTTATAGGCTGGGCACGG + Intronic
1178637242 21:34314877-34314899 CTTGATTTCAAGGCTGGGCATGG + Intergenic
1180017911 21:45099368-45099390 AATAATTTACAGGCTGGGCGCGG + Intronic
1180217319 21:46333608-46333630 AAAAAATTACAGGCTGGGCACGG + Intronic
1180562666 22:16632853-16632875 ATCAATATAGAGGCTGGGCACGG + Intergenic
1180565196 22:16657629-16657651 ATTAATTCCCAGGCTGGGCATGG + Intergenic
1180616619 22:17132506-17132528 AAAAAATTACAGGCTGGGCACGG + Intergenic
1180693455 22:17737238-17737260 CACAGTCTAAAGGCTGGGCATGG - Intronic
1180797796 22:18615507-18615529 CACCACTTTCAGGCTGGGCATGG - Intergenic
1180957875 22:19749328-19749350 CTCAAGGAACAGGCTGGGCTTGG - Intergenic
1181223920 22:21379753-21379775 CACCACTTTCAGGCTGGGCATGG + Intergenic
1181254713 22:21555064-21555086 CACCACTTTCAGGCTGGGCATGG - Intronic
1181289855 22:21783460-21783482 TTGGAATTACAGGCTGGGCATGG - Intronic
1182230267 22:28832475-28832497 ACAACTTTACAGGCTGGGCATGG - Intergenic
1182485824 22:30638073-30638095 ATGATTTGACAGGCTGGGCATGG + Intronic
1182498637 22:30729345-30729367 CTAAAATTATTGGCTGGGCACGG + Intronic
1182612302 22:31559095-31559117 CTCAATAAATAGGCTGGGCCCGG - Intronic
1182898435 22:33877630-33877652 ATTAAAATACAGGCTGGGCACGG + Intronic
1183603601 22:38854761-38854783 CTGAAATTTCAGGCCGGGCACGG + Intergenic
1183772357 22:39938090-39938112 CCCAAGTTACAGGCAGGGGAGGG + Intronic
1184016808 22:41792380-41792402 TTCAAGTCAGAGGCTGGGCAGGG - Intronic
1184380054 22:44139744-44139766 CTCAAAACACAGGCTGGGCCGGG - Intronic
1184431895 22:44445866-44445888 CTGAATTTAGAGGCAGGGAAAGG - Intergenic
1184436598 22:44482383-44482405 AACAATTAAGAGGCTGGGCACGG - Intergenic
1184577136 22:45379278-45379300 CTGAATGTTGAGGCTGGGCATGG - Intronic
1184839110 22:47042242-47042264 CTCAGTTACCAGGCTGTGCATGG + Intronic
1185095681 22:48804834-48804856 GTCACTTTGCAGGCTGGTCAAGG - Intronic
1185155941 22:49193613-49193635 CCTAATTTCCAGCCTGGGCAGGG - Intergenic
1185349029 22:50324712-50324734 ATCACTTTGAAGGCTGGGCATGG - Intronic
1203294379 22_KI270736v1_random:27211-27233 CTCATAAAACAGGCTGGGCATGG + Intergenic
949129910 3:487412-487434 TTCAATTTGCAGTCTGAGCAGGG + Intergenic
949148179 3:730191-730213 CTAAATTCTCAGGCTGGGCGTGG + Intergenic
949983607 3:9520632-9520654 CTCAAGATAGAGGCCGGGCAGGG - Intronic
950949667 3:16985187-16985209 CTGAATTTTAAGGCTGGGAATGG + Intronic
951209731 3:19962277-19962299 TACAATCTACAGGCTGGGCGTGG + Intronic
951340472 3:21480391-21480413 AAAAATTTTCAGGCTGGGCACGG - Intronic
951479948 3:23149594-23149616 GTCAACATACAAGCTGGGCATGG - Intergenic
951896757 3:27616828-27616850 CACATATTTCAGGCTGGGCACGG - Intergenic
952150692 3:30586791-30586813 CTCAATTTCCAGTTTGGGTATGG + Intergenic
952180052 3:30907686-30907708 CTCAGTTTACAGTATGAGCACGG + Intergenic
952281721 3:31929841-31929863 CATAGTTCACAGGCTGGGCATGG + Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953525508 3:43687158-43687180 AAACATTTACAGGCTGGGCATGG + Intronic
953641521 3:44712481-44712503 CTGGAGTTACAGGCTGGGCTTGG + Intergenic
953654765 3:44841369-44841391 TTAAATTTACTGGCTGGGCATGG - Intronic
954099053 3:48355503-48355525 TTCAATTCACAGGATGGGCATGG - Intergenic
954099870 3:48362702-48362724 TTGAAATTATAGGCTGGGCATGG + Intergenic
954225733 3:49179845-49179867 ATCAATAAACAGGCTGGGCACGG + Intronic
954243374 3:49311451-49311473 CTCAAGATACAGCCTGGGAAAGG + Intronic
954356468 3:50086134-50086156 ATTATTTTGCAGGCTGGGCATGG + Intronic
954645477 3:52128987-52129009 TAGAATTTCCAGGCTGGGCATGG + Intronic
955037736 3:55285208-55285230 CACAATTCTCAGGCTTGGCATGG - Intergenic
955879094 3:63524666-63524688 CTCAATTTGCAGCCTGTTCAAGG + Intronic
956337632 3:68181914-68181936 TACAGTTTACAGGCTGGGGATGG + Intronic
956804585 3:72796528-72796550 GTCAAATAACAGGCAGGGCATGG + Intronic
956811347 3:72866745-72866767 CACTTTTTAGAGGCTGGGCATGG - Intergenic
957543277 3:81603784-81603806 TTAAATTTATAGGCTGGGCATGG - Intronic
957608052 3:82429830-82429852 ATCAAGTAACTGGCTGGGCACGG - Intergenic
957629512 3:82701187-82701209 ATGCATTAACAGGCTGGGCACGG - Intergenic
958001132 3:87750292-87750314 ATCATATTGCAGGCTGGGCACGG + Intergenic
958570126 3:95869389-95869411 TTTAGTTTACAGGCTGGGCACGG - Intergenic
958708737 3:97690766-97690788 CTCAATTTAAAAAATGGGCAAGG - Intronic
958912611 3:100011351-100011373 CTCAAGAAACACGCTGGGCATGG - Intronic
959060762 3:101614217-101614239 ATAGAGTTACAGGCTGGGCAAGG - Intergenic
959363568 3:105427133-105427155 CTCCATTTTCACCCTGGGCATGG - Intronic
960031794 3:113061305-113061327 GTAAAATTAGAGGCTGGGCAGGG - Intergenic
960189081 3:114681449-114681471 CAAGATTTACAGGCTGGGCGTGG - Intronic
960959893 3:123062994-123063016 ATCAAGATACAGGCTGGGCATGG + Intergenic
961318784 3:126058178-126058200 CGGAATCTACAGGTTGGGCAGGG - Intronic
961727437 3:128941770-128941792 CTAAATTTGCAGGGTGGGCCGGG - Intronic
961857206 3:129884335-129884357 AAGAATTTTCAGGCTGGGCATGG + Intronic
961886412 3:130099348-130099370 CTCTGTTTCCAGGCTGGGCTGGG - Intronic
962094995 3:132284481-132284503 CTCTATTTCCATGCTTGGCAAGG + Intronic
962523151 3:136215313-136215335 ATCAAATTGAAGGCTGGGCATGG - Intergenic
962780996 3:138716963-138716985 AGTAGTTTACAGGCTGGGCACGG + Intronic
963877103 3:150488541-150488563 CTCAACTAATTGGCTGGGCATGG - Intergenic
965055389 3:163706480-163706502 CTCATTTTACAAGCTGTGAATGG - Intergenic
965436657 3:168661125-168661147 TGCTAGTTACAGGCTGGGCATGG + Intergenic
965543628 3:169893810-169893832 TGCAGTATACAGGCTGGGCACGG - Intergenic
965583895 3:170298161-170298183 TTCAATTTTTTGGCTGGGCATGG - Intronic
965602851 3:170472076-170472098 TTCAATATTCTGGCTGGGCACGG + Intronic
965895536 3:173570990-173571012 ATAAATTAATAGGCTGGGCATGG - Intronic
965997875 3:174909096-174909118 CTAAATTTATAGGCTAGGCACGG + Intronic
966586558 3:181632869-181632891 GTAAATTTATTGGCTGGGCATGG - Intergenic
966996919 3:185292012-185292034 TTGAGTTAACAGGCTGGGCACGG + Intronic
967332583 3:188306377-188306399 CACAATTTTCAGGCCAGGCACGG - Intronic
968147551 3:196312168-196312190 CAAAATTTAGGGGCTGGGCATGG - Intronic
968163409 3:196445380-196445402 CTACACTTACAGGCTGGGCGTGG - Intergenic
968263322 3:197342577-197342599 ATAAAATTTCAGGCTGGGCACGG + Intergenic
968406208 4:341349-341371 CTCACAAAACAGGCTGGGCACGG - Intronic
968721737 4:2211706-2211728 CTCAATTAATTAGCTGGGCATGG + Intronic
970335265 4:15032251-15032273 ACCCATTTAGAGGCTGGGCATGG - Intronic
970554714 4:17219795-17219817 ATCACTTTTCAGGCTGGGCTTGG + Intergenic
970911635 4:21283921-21283943 TGCAATTTACTGGCCGGGCACGG + Intronic
971647509 4:29228449-29228471 AACAATTTAGTGGCTGGGCATGG + Intergenic
972611144 4:40656720-40656742 GGCACTTTTCAGGCTGGGCATGG + Intergenic
972619413 4:40732649-40732671 CTTCAGATACAGGCTGGGCACGG - Intergenic
973240565 4:47952070-47952092 ATCTATGTTCAGGCTGGGCATGG + Intronic
975600796 4:76097495-76097517 TGCAAATTGCAGGCTGGGCATGG - Intronic
975706014 4:77112754-77112776 CTTATTGTACATGCTGGGCAGGG + Intergenic
976235273 4:82890566-82890588 CTCAAAGTACAGGCTGCGCCTGG + Intronic
976744289 4:88388258-88388280 CTAAAAATATAGGCTGGGCACGG + Intronic
977333819 4:95669873-95669895 ATCAATTTACCGTCAGGGCAAGG + Intergenic
977874301 4:102130638-102130660 CTAACTTTACTGGCCGGGCATGG + Intergenic
978213943 4:106174830-106174852 TTCAATTTCCAGGCCAGGCACGG + Intronic
978308869 4:107363851-107363873 GTCACTTCACGGGCTGGGCATGG + Intergenic
979370902 4:119884960-119884982 CTCTATTTCATGGCTGGGCAGGG - Intergenic
980067999 4:128212351-128212373 AACAATTAATAGGCTGGGCATGG + Intronic
980559294 4:134451672-134451694 TTTAAAATACAGGCTGGGCATGG - Intergenic
980840208 4:138250152-138250174 TACAATTTACAGGCCAGGCACGG - Intergenic
980928873 4:139166045-139166067 CTCTAAAAACAGGCTGGGCATGG + Intronic
981348825 4:143704747-143704769 GTCAAGGTACAGGCTGGGCACGG + Intergenic
982003010 4:151038244-151038266 AACACTTTCCAGGCTGGGCATGG - Intergenic
982934462 4:161453882-161453904 CATAATGTGCAGGCTGGGCATGG - Intronic
982948078 4:161652144-161652166 ATCAATTTTCAGGCTGGACATGG + Intronic
983528225 4:168782617-168782639 CTTTATTTACAGGCCGGTCACGG + Intronic
983587620 4:169372573-169372595 TTTAATTTAGGGGCTGGGCATGG - Intergenic
984539262 4:181017280-181017302 CTCAAAATTCAGGCCGGGCATGG - Intergenic
984771507 4:183440636-183440658 TTAAAATTACAGGCTGGGCGTGG - Intergenic
984868067 4:184300065-184300087 GAGAATTCACAGGCTGGGCATGG - Intergenic
985444102 4:190010946-190010968 TTAACTTTAGAGGCTGGGCATGG + Intergenic
986405648 5:7422329-7422351 ATCATTAAACAGGCTGGGCACGG - Intronic
986697276 5:10368861-10368883 CTCAAACTCCTGGCTGGGCACGG - Intronic
986859124 5:11905025-11905047 CTCAAGTTCCAGACTGGGCAAGG - Intergenic
987554988 5:19435379-19435401 CTCTATGTACAGGCTGTGCCTGG - Intergenic
988470727 5:31534719-31534741 CTTTATTTACAAGCTGGGCATGG + Intronic
988684304 5:33513021-33513043 ATCAATTATCAGGCTGGGCACGG - Intergenic
989032596 5:37135081-37135103 GAAAATTTAGAGGCTGGGCATGG - Intronic
989573287 5:42965288-42965310 TTTAATTTATAGGCTGGCCACGG - Intergenic
990390996 5:55320505-55320527 AACAATTTTTAGGCTGGGCAGGG - Intronic
990445997 5:55895005-55895027 GTAAAATTACTGGCTGGGCACGG - Intronic
990576989 5:57132869-57132891 CACACATTAGAGGCTGGGCATGG - Intergenic
991267982 5:64745298-64745320 CTGATGATACAGGCTGGGCATGG + Intronic
991696979 5:69282180-69282202 ATTACATTACAGGCTGGGCATGG - Exonic
991727146 5:69546766-69546788 GAAAATTTTCAGGCTGGGCATGG - Intronic
991867811 5:71081108-71081130 GAAAATTTTCAGGCTGGGCATGG + Intergenic
992059713 5:73030330-73030352 ATCAATTTCTTGGCTGGGCATGG - Intronic
992399245 5:76396546-76396568 GTCATTTTAAAGGCTGGGCGTGG - Intergenic
992632734 5:78697668-78697690 CCTTATGTACAGGCTGGGCATGG + Intronic
992857588 5:80878590-80878612 ATAAATTTAAAGGCTGGGCGTGG + Intergenic
993061764 5:83047101-83047123 ATCATGTTACAGGCTAGGCACGG - Intergenic
997154626 5:131540871-131540893 TTCAATTCACAGGCTGGGCGTGG + Intronic
997155433 5:131551221-131551243 GTTAATTCACAGGCTGGGCAGGG + Intronic
997314920 5:132924560-132924582 CTCAAACTGCAGGCTGGGCGCGG + Intronic
997424692 5:133795190-133795212 CTGAATGTACAGGCTGGCTATGG + Intergenic
997847602 5:137302277-137302299 ATCAGTTTATAGGCTGGGCGCGG + Intronic
997988226 5:138521818-138521840 TTTAACTTACAGGCTGGGCGCGG - Intronic
998025041 5:138809138-138809160 ATTTATTTATAGGCTGGGCATGG - Intronic
998281580 5:140813703-140813725 TTCTTTTTACAGGCTGGTCATGG + Intronic
999761341 5:154703460-154703482 TTCATTCAACAGGCTGGGCATGG + Intergenic
1000150048 5:158491283-158491305 CTCAATTCACATCCTGGGGAGGG + Intergenic
1000704114 5:164489772-164489794 CCCATGTTAAAGGCTGGGCAAGG + Intergenic
1001090733 5:168738646-168738668 AGCAACTCACAGGCTGGGCACGG + Intronic
1001133641 5:169084596-169084618 CCCAATTTTGAGGCTGGGCACGG - Intronic
1001618608 5:173063035-173063057 ATGATTTTACAGGCTGGGCGCGG - Intronic
1002035479 5:176465655-176465677 TTCAATTTCTGGGCTGGGCATGG - Intronic
1002119245 5:176988969-176988991 TTCACCTAACAGGCTGGGCACGG - Intronic
1002388235 5:178887609-178887631 CTTTCTTTCCAGGCTGGGCATGG + Intronic
1002718319 5:181242847-181242869 CTCAGGATACAGGCTGGGCGCGG - Intronic
1002907891 6:1465666-1465688 ATAAATAAACAGGCTGGGCATGG + Intergenic
1003097315 6:3152734-3152756 CTCTAGCTTCAGGCTGGGCACGG + Exonic
1003509299 6:6765950-6765972 CTTTATTTATAGGCTGGGCACGG + Intergenic
1004672020 6:17806587-17806609 AACAATTTTCTGGCTGGGCACGG + Intronic
1004727561 6:18325940-18325962 AGTAATTCACAGGCTGGGCATGG - Intergenic
1004934471 6:20494086-20494108 TTCAATTAATAGGCTGGGCGCGG - Intergenic
1005970138 6:30754372-30754394 ATGAAACTACAGGCTGGGCAAGG + Intergenic
1006682958 6:35810424-35810446 CACAAAAAACAGGCTGGGCATGG + Intronic
1006807069 6:36795467-36795489 CCCTATCTCCAGGCTGGGCATGG - Intronic
1007413973 6:41681367-41681389 AAGAATTTCCAGGCTGGGCACGG + Intergenic
1010237142 6:73584395-73584417 CTAAAAATACAGGCTGGGCTCGG + Intergenic
1010283321 6:74045604-74045626 CTAAAATTATAGGCTGGGCATGG - Intergenic
1010340810 6:74750255-74750277 CTCAATTCTCAGGCTGGGAAGGG + Intergenic
1010418595 6:75644773-75644795 AGAAATTTACCGGCTGGGCAAGG - Intronic
1012457043 6:99418856-99418878 GACAATTTACTGGCTGGGCACGG + Intronic
1012899418 6:104989883-104989905 TTCATTTCACTGGCTGGGCATGG - Intronic
1013062864 6:106654059-106654081 ATCATCTAACAGGCTGGGCACGG + Intronic
1013096647 6:106951576-106951598 TTCAATGTTTAGGCTGGGCACGG - Intergenic
1013120138 6:107133789-107133811 TGAAATTTTCAGGCTGGGCATGG + Intergenic
1013524553 6:110962192-110962214 ATACATTAACAGGCTGGGCACGG - Intronic
1013775894 6:113678075-113678097 CTAAAGTTTCAGGCTGAGCATGG + Intergenic
1013999460 6:116348135-116348157 GTCAAGAAACAGGCTGGGCACGG + Intronic
1014108119 6:117590279-117590301 ATGTATTTCCAGGCTGGGCATGG + Intronic
1014172200 6:118291081-118291103 GTCAATTTTCTGGCTGGGCATGG - Intronic
1014576919 6:123085089-123085111 ATCACTTTATAGGCTGGGCATGG + Intergenic
1016477118 6:144439791-144439813 GAAAATTTATAGGCTGGGCATGG - Intronic
1016944058 6:149511563-149511585 AGCAATTTACAGGCTGGGTACGG - Intronic
1017166580 6:151413528-151413550 CACCACTTACTGGCTGGGCACGG - Intronic
1017837651 6:158193702-158193724 AAGAATTTCCAGGCTGGGCACGG + Exonic
1018374222 6:163195713-163195735 CTCCATTTCCCGGCAGGGCAGGG - Intronic
1018783823 6:167092770-167092792 CTCCATTTGGAGGCTGTGCAGGG - Intergenic
1019377057 7:698107-698129 AGAAATTAACAGGCTGGGCAGGG + Intronic
1020270754 7:6593939-6593961 CTCACTGACCAGGCTGGGCACGG - Intronic
1020412068 7:7903426-7903448 ATGAAAATACAGGCTGGGCATGG + Intronic
1021088918 7:16457734-16457756 ATCTGTTTGCAGGCTGGGCATGG - Intergenic
1021089035 7:16459406-16459428 ATCTGTTTGCAGGCTGGGCATGG - Intergenic
1021367967 7:19805010-19805032 TTCAGTTTTCAGGCTGGGCGCGG - Intergenic
1021673063 7:23051896-23051918 GTCAATTAACAGCCTGGGCACGG + Intergenic
1022306299 7:29149482-29149504 ATGGATTTCCAGGCTGGGCACGG - Intronic
1022528295 7:31052263-31052285 CTCACTTCACAGGCTGGGGAGGG - Intergenic
1022724125 7:32965418-32965440 GACAAATGACAGGCTGGGCATGG - Intronic
1023293555 7:38691983-38692005 ATAAACTTCCAGGCTGGGCATGG - Intergenic
1025049486 7:55722496-55722518 GACAAATGACAGGCTGGGCATGG + Intergenic
1025169042 7:56739641-56739663 AATAATTTATAGGCTGGGCATGG + Intergenic
1025703349 7:63840245-63840267 AATAATTTATAGGCTGGGCATGG - Intergenic
1025805637 7:64830611-64830633 ATGAAGATACAGGCTGGGCATGG - Intronic
1025905763 7:65783647-65783669 CCAAAATTATAGGCTGGGCATGG - Intergenic
1026016720 7:66677470-66677492 AGAAATCTACAGGCTGGGCATGG + Intronic
1028081434 7:86582757-86582779 CACTATGGACAGGCTGGGCACGG + Intergenic
1028615037 7:92756343-92756365 CTCAATTTTGTGGCTGGGCATGG + Intronic
1028997452 7:97117162-97117184 CCCAATTTATACTCTGGGCATGG - Exonic
1029239823 7:99151892-99151914 AACAATGTATAGGCTGGGCACGG + Intergenic
1029559491 7:101293125-101293147 CTCAAGCACCAGGCTGGGCACGG - Intergenic
1029801240 7:102949813-102949835 CTCACAATCCAGGCTGGGCATGG + Intronic
1030389721 7:108911895-108911917 CTAAAATTATGGGCTGGGCATGG - Intergenic
1030543505 7:110863239-110863261 CTCACTTTACATGTTGGTCATGG + Intronic
1031608799 7:123800457-123800479 TTTAATTTTCAGGCCGGGCACGG - Intergenic
1031856338 7:126927425-126927447 CACAATAAACAGGCTGGGCATGG - Intronic
1032208518 7:129890842-129890864 GTCAACTTATAGGCTGGGCATGG + Intronic
1032302174 7:130697466-130697488 CTAATTTTATAGGCTGGGCATGG + Intergenic
1032815741 7:135472185-135472207 ATAAATATACAGGCTGGGCGTGG + Intronic
1032900983 7:136307568-136307590 CCAAGTTAACAGGCTGGGCATGG - Intergenic
1033334996 7:140444812-140444834 ATCAATATCCAGGCTGGGCGGGG + Intergenic
1033343511 7:140509982-140510004 CTCACTGAACAGGTTGGGCAGGG - Intergenic
1033357147 7:140609220-140609242 TTTAATTAACTGGCTGGGCATGG + Intronic
1033405495 7:141068876-141068898 CTCAGTTTTAAGACTGGGCAGGG - Intergenic
1034057853 7:148055172-148055194 GCCTATTTATAGGCTGGGCATGG - Intronic
1034283290 7:149868242-149868264 CTCCACTCTCAGGCTGGGCAGGG + Intergenic
1034340961 7:150354747-150354769 ATAATTTTTCAGGCTGGGCACGG + Intergenic
1034390411 7:150782905-150782927 TTCTATTTTCTGGCTGGGCACGG + Intergenic
1034749552 7:153555902-153555924 ATAAGATTACAGGCTGGGCAAGG - Intergenic
1035666177 8:1381527-1381549 TTCAAGTCACAGGATGGGCAAGG - Intergenic
1037266989 8:17074174-17074196 TCCACTATACAGGCTGGGCACGG - Intronic
1037479479 8:19290781-19290803 CTTAATTTTTAGGCCGGGCACGG + Intergenic
1037873919 8:22527923-22527945 ATCTATGTAGAGGCTGGGCACGG - Intronic
1038282992 8:26182477-26182499 CCCAAACTACAGGCTGGGCGTGG + Intergenic
1038308210 8:26423617-26423639 TTCATTTTACTGGCTGGGCATGG + Intronic
1038615356 8:29089144-29089166 CTAATATTACAGTCTGGGCATGG + Intronic
1038815727 8:30902075-30902097 CTGAATCTAGAGGCTGGGCCCGG + Intergenic
1039071906 8:33656475-33656497 CTAAAAATAGAGGCTGGGCATGG - Intergenic
1039461750 8:37751007-37751029 AAGAATTAACAGGCTGGGCACGG - Intronic
1039818667 8:41117043-41117065 TCCAATTTATAGGCTGGGCATGG - Intergenic
1040637140 8:49288390-49288412 GTCACTGTGCAGGCTGGGCAAGG - Intergenic
1040999417 8:53435969-53435991 TACATTTTAGAGGCTGGGCATGG - Intergenic
1041251958 8:55943308-55943330 AAGAATTTTCAGGCTGGGCATGG + Intronic
1041466169 8:58159603-58159625 AACTATTTGCAGGCTGGGCACGG + Intronic
1041548973 8:59079184-59079206 CAAAATTTGCAGGCTGGCCATGG + Intronic
1041731847 8:61070542-61070564 CTCAATTCAGAGGCCTGGCAGGG + Intronic
1041813697 8:61941882-61941904 CTCAATCTGCAATCTGGGCAAGG + Intergenic
1042277954 8:67025400-67025422 CTCAAGTGATAGGCTGGGCATGG - Intronic
1042364816 8:67923949-67923971 ATCACTTTAAAGGCTGGGCACGG - Intergenic
1042588498 8:70370173-70370195 TTTAGTTTAAAGGCTGGGCACGG - Intronic
1042840811 8:73121667-73121689 AGCAATTTACAGGCTGGCAAGGG + Intronic
1045037881 8:98190611-98190633 CTTTATTTACAGGCCAGGCATGG - Exonic
1045058349 8:98389526-98389548 ATCAAATTACAGGAAGGGCATGG + Intergenic
1045463760 8:102450095-102450117 CACAAATATCAGGCTGGGCATGG - Intergenic
1045484368 8:102619532-102619554 TACAGTTTATAGGCTGGGCATGG + Intergenic
1045520045 8:102895550-102895572 ATCCATTTACAGCATGGGCATGG + Intronic
1046172850 8:110534272-110534294 CTAGCTTTTCAGGCTGGGCACGG - Intergenic
1046434748 8:114173116-114173138 AACCAATTACAGGCTGGGCACGG + Intergenic
1047012799 8:120690770-120690792 CTCCAGGTACAGGCTGAGCAGGG - Intronic
1047094254 8:121607149-121607171 GTAAATTTGAAGGCTGGGCATGG - Intergenic
1047461723 8:125072048-125072070 CTATATTTACAGGCTGGGCATGG + Intronic
1047935494 8:129773492-129773514 CTCAATGTATAGGCCGGGCATGG + Intronic
1048003299 8:130397429-130397451 ATAAATATACGGGCTGGGCATGG - Intronic
1048077764 8:131091780-131091802 ATAAATATACTGGCTGGGCATGG - Intergenic
1048890709 8:138943959-138943981 AACAAGTTACTGGCTGGGCACGG + Intergenic
1049699324 8:144001414-144001436 TTCAAAATACAGGCTGGGCGTGG + Intronic
1050266422 9:3895275-3895297 CTAAATTTACAGGCCTGGCCTGG + Intronic
1050306682 9:4312175-4312197 GAAACTTTACAGGCTGGGCATGG + Intronic
1050342255 9:4652557-4652579 ATAAATTTAAAGGCTGGGTACGG + Intronic
1050454180 9:5817186-5817208 CTCAAAAAAAAGGCTGGGCACGG - Intronic
1050505609 9:6345585-6345607 ATCAATAGGCAGGCTGGGCATGG - Intergenic
1051262694 9:15280186-15280208 CTTTATTTACAGGCCGGGCACGG - Intronic
1051651058 9:19325005-19325027 GAAAATTTACTGGCTGGGCATGG - Intronic
1052246451 9:26341359-26341381 GTGAATTTACAGGCTGGGTGCGG - Intergenic
1052924666 9:34004810-34004832 GTAAATTTTAAGGCTGGGCACGG + Intronic
1053070018 9:35095721-35095743 TCCTATTTCCAGGCTGGGCATGG + Intronic
1053395357 9:37769015-37769037 ATCTATTTTGAGGCTGGGCACGG + Intronic
1055741334 9:79392911-79392933 TTAAAAATACAGGCTGGGCATGG + Intergenic
1056024147 9:82475210-82475232 ATCCATGTATAGGCTGGGCATGG + Intergenic
1056216025 9:84406855-84406877 AACAAAATACAGGCTGGGCATGG - Intergenic
1056230350 9:84536969-84536991 CTCAAAGTACAGGCCAGGCATGG - Intergenic
1056538445 9:87551434-87551456 CTAAATTAACAGGCTGCGCACGG - Intronic
1056963898 9:91150156-91150178 CTTAATTTTTGGGCTGGGCATGG - Intergenic
1057382684 9:94583143-94583165 CATATTTAACAGGCTGGGCATGG - Intronic
1057431069 9:94994659-94994681 ATCAGATTTCAGGCTGGGCATGG + Intronic
1057459888 9:95251604-95251626 ATTAAATTACTGGCTGGGCACGG - Intronic
1057494258 9:95547620-95547642 CTCAACATTGAGGCTGGGCATGG + Intergenic
1057614403 9:96575983-96576005 CAGAATTCACAGGCTGGGCTTGG + Intronic
1059103507 9:111491805-111491827 CTCTCATTTCAGGCTGGGCATGG - Intergenic
1059173016 9:112144494-112144516 AACAATTTACAGGCCTGGCACGG + Intronic
1059701377 9:116778120-116778142 TGCAATTTACAGGCCAGGCATGG - Intronic
1059703969 9:116802502-116802524 CTCATTTTACATGCAGGGAAAGG - Intronic
1059755916 9:117293377-117293399 CTCCATTTACAGTCTTTGCATGG + Intronic
1060170762 9:121459164-121459186 TGCTATTTTCAGGCTGGGCATGG + Intergenic
1061114344 9:128599423-128599445 ATCAATTTCTGGGCTGGGCATGG - Intronic
1061497553 9:130983706-130983728 CTAACTTTACAGGCCGGACACGG + Intergenic
1062670214 9:137704396-137704418 CTCAATCTACAACCAGGGCAAGG - Intronic
1203627537 Un_KI270750v1:38499-38521 TAAATTTTACAGGCTGGGCATGG - Intergenic
1186552578 X:10522125-10522147 CTCTATTTTCAGGCCAGGCATGG - Intronic
1187146776 X:16644426-16644448 CTCAATTTACAGGCTGGGCATGG - Intronic
1187517638 X:19987094-19987116 ATAAATGTACTGGCTGGGCATGG - Intergenic
1187632849 X:21194244-21194266 CTCAATTTACAATCTGTGAATGG - Intergenic
1187712888 X:22071934-22071956 CTAAAAATACAGGCTGGGCGCGG + Intronic
1187897342 X:23994965-23994987 TTACATTTTCAGGCTGGGCAAGG - Intronic
1188349381 X:29108689-29108711 CTCATTGTATAGGCTGGGCGTGG - Intronic
1188393790 X:29655370-29655392 AGCAATCTACAGGCTGGGCCTGG + Intronic
1188487656 X:30701117-30701139 CTAAATTTGTAGGCTGGGCGCGG + Intronic
1188882200 X:35502577-35502599 CACAATGTAGAGGCTGGGCGCGG - Intergenic
1189231572 X:39456110-39456132 TTCAATTAACAGGCTGGACAAGG - Intergenic
1189391424 X:40580187-40580209 CTCAGTTTCCAATCTGGGCAAGG - Intergenic
1189788198 X:44578773-44578795 CACATTTCATAGGCTGGGCATGG + Intergenic
1189997497 X:46653102-46653124 CTACTTTTTCAGGCTGGGCATGG + Intronic
1190079093 X:47341244-47341266 GCCCATTTTCAGGCTGGGCATGG - Intergenic
1190307761 X:49095348-49095370 CAGAAAATACAGGCTGGGCACGG + Intronic
1192526717 X:71852283-71852305 AACAAGTTATAGGCTGGGCATGG + Intergenic
1192548497 X:72033473-72033495 GTCAATTCAGAGGCCGGGCACGG - Intergenic
1192750846 X:73989724-73989746 ATAAAAGTACAGGCTGGGCACGG + Intergenic
1192751015 X:73991134-73991156 TTAAATTTACCAGCTGGGCATGG - Intergenic
1192893154 X:75411500-75411522 CGAAATGTACAGGCTGGGCGCGG - Intronic
1193124432 X:77856143-77856165 TAAAATTTTCAGGCTGGGCATGG + Intronic
1193382889 X:80836735-80836757 TTCAATTTTCTGGCTGGGCGTGG - Intergenic
1193872339 X:86815289-86815311 CTCCATTTACAGGATCTGCAGGG - Intronic
1194122536 X:89977649-89977671 ATAAATTTCCAGGCTGGGCATGG + Intergenic
1194233324 X:91350781-91350803 ATCTAAATACAGGCTGGGCACGG - Intergenic
1196466685 X:115979057-115979079 TAAAATTTCCAGGCTGGGCATGG - Intergenic
1196604827 X:117645270-117645292 ATGATTTCACAGGCTGGGCATGG + Intergenic
1196781876 X:119390867-119390889 TCCTATTTATAGGCTGGGCATGG - Intergenic
1197259521 X:124303181-124303203 AGAAATTAACAGGCTGGGCACGG - Intronic
1197627298 X:128816468-128816490 CTCAAATTCCATGCTGTGCAAGG + Intergenic
1198023424 X:132681492-132681514 CAGAATTTAAGGGCTGGGCATGG + Intronic
1198136853 X:133761437-133761459 ATATATTTACAGGCTGGTCATGG - Intronic
1198550461 X:137739990-137740012 ATCAATTAGCAGGCTGGGCATGG + Intergenic
1199263319 X:145801147-145801169 AAAAATGTACAGGCTGGGCACGG - Intergenic
1199840044 X:151636692-151636714 ATGAAAATACAGGCTGGGCACGG - Intronic
1199963800 X:152801270-152801292 CTGAAATTACAGGCTGCGCAGGG + Intergenic
1200475395 Y:3635088-3635110 ATAAATTTCCAGGCTGGGCATGG + Intergenic
1202110429 Y:21411324-21411346 CATAATTTGAAGGCTGGGCAGGG + Intergenic
1202592967 Y:26506944-26506966 ATCAATATAGAGGCTGTGCACGG + Intergenic
1202601575 Y:26598585-26598607 ATTAATTTCCAGGCTGGGCATGG + Intergenic