ID: 1187147832

View in Genome Browser
Species Human (GRCh38)
Location X:16653953-16653975
Sequence TATTACATGAGGCAGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187147832_1187147835 -5 Left 1187147832 X:16653953-16653975 CCTGCCTGCTGCCTCATGTAATA 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1187147835 X:16653971-16653993 TAATATGTCAGCCCTAGCCCTGG 0: 1
1: 0
2: 0
3: 7
4: 97
1187147832_1187147841 21 Left 1187147832 X:16653953-16653975 CCTGCCTGCTGCCTCATGTAATA 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1187147841 X:16653997-16654019 AGGAGACAAACCCAGCTTCCAGG 0: 1
1: 0
2: 2
3: 18
4: 222
1187147832_1187147836 1 Left 1187147832 X:16653953-16653975 CCTGCCTGCTGCCTCATGTAATA 0: 1
1: 0
2: 0
3: 10
4: 139
Right 1187147836 X:16653977-16653999 GTCAGCCCTAGCCCTGGAGCAGG 0: 1
1: 0
2: 1
3: 25
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187147832 Original CRISPR TATTACATGAGGCAGCAGGC AGG (reversed) Intronic
902652478 1:17845554-17845576 TTTTACAGCAGGCAGCAGGTTGG - Intergenic
903859376 1:26355694-26355716 TATTATAGGAAGCAGCAGGGCGG - Intergenic
904527335 1:31143718-31143740 TATTCCCTGAGGCCCCAGGCTGG - Intergenic
905977348 1:42186212-42186234 TAAAACAAGAGGAAGCAGGCTGG + Intronic
907500750 1:54878169-54878191 TATTACCTGAGGCTGAAGCCAGG + Intronic
912474643 1:109927860-109927882 TAGAAGATGGGGCAGCAGGCTGG + Intronic
917726212 1:177829838-177829860 TATAACATTTGGCAACAGGCAGG - Intergenic
921911563 1:220554592-220554614 TAGTAAATGAAGCAGCAAGCTGG + Intronic
924053959 1:240106469-240106491 TAATACATAAGGGAGCAGGTTGG - Intronic
1062930018 10:1346717-1346739 CACTACCTGGGGCAGCAGGCCGG + Intronic
1063720812 10:8579715-8579737 TAGTGCATGAGGCAGAAGCCTGG + Intergenic
1070624312 10:78038926-78038948 TTTTAAATGAGGTAACAGGCTGG - Intronic
1075174344 10:120145240-120145262 TATGATATGAAGCAGCTGGCAGG + Intergenic
1077102816 11:829718-829740 CATTTCATGAGGCAGCAGCCAGG + Intronic
1077516137 11:3003152-3003174 TATTAGTGGAGCCAGCAGGCTGG + Intronic
1078613465 11:12842447-12842469 TAATAAATGAGGCAGCAGTGTGG - Intronic
1078841744 11:15082958-15082980 TCTCTCATGAGGCTGCAGGCAGG - Intergenic
1080920277 11:36701874-36701896 TTTCCCATGAGGCAGCAGGGTGG - Intergenic
1082296434 11:50445826-50445848 TATTATATGAGGCCTCAGGGAGG - Intergenic
1084953671 11:72680120-72680142 TATTACATAAGCCAGGAGGGAGG + Intergenic
1085432521 11:76465971-76465993 TATTACTCGAGGCAGGAGACTGG - Intronic
1087814026 11:102638721-102638743 TTCTTCATGAGGCAGCAGGAGGG + Intergenic
1089331361 11:117691185-117691207 TGTTACGTGAGGAAGCAGGTGGG + Intronic
1090009063 11:123029842-123029864 TATTACAGGAAGTAACAGGCAGG - Intergenic
1094260273 12:28488928-28488950 TATAAAAGCAGGCAGCAGGCCGG - Intronic
1097742423 12:63259218-63259240 TATAAAATCAGGCAGCTGGCTGG - Intergenic
1098785310 12:74745985-74746007 TATTAAATGTAGCAGCAGACAGG - Intergenic
1098870801 12:75814906-75814928 TAAAACATGAGGCAACAGCCAGG - Intergenic
1099974307 12:89530324-89530346 TATTCTAGGAGGCAGAAGGCAGG - Intergenic
1100735910 12:97530671-97530693 TATGACATTAGCCAGCTGGCGGG - Intergenic
1100783019 12:98049418-98049440 TATTAGATGAGGTTGCATGCAGG + Intergenic
1103339446 12:120213712-120213734 TATTAATTGGGGGAGCAGGCAGG - Intronic
1106988066 13:35379683-35379705 TATGGCATGAGGCAGAAGTCAGG + Intronic
1107952154 13:45473163-45473185 CATTACAAGAGGAAACAGGCCGG - Intronic
1110907661 13:80912979-80913001 TATTAGAAAAGGCAGCACGCTGG - Intergenic
1113283426 13:108816656-108816678 AATTACATGATGCAGGAAGCTGG - Intronic
1114161879 14:20177477-20177499 AATTACATGATGCAGGAAGCTGG + Intergenic
1114821196 14:26021186-26021208 TATTGCATAAGGCAGCGGGGAGG - Intergenic
1118530360 14:66697981-66698003 TATAAAACCAGGCAGCAGGCTGG - Intronic
1120508454 14:85382377-85382399 GGTAACATGAGGAAGCAGGCTGG + Intergenic
1127560019 15:60126968-60126990 TACTACACTAGGCAGTAGGCAGG + Intergenic
1128343416 15:66838357-66838379 TATGACAGGAGGCAGCACTCAGG + Intergenic
1128912598 15:71529853-71529875 TATTACGTCAGGCATTAGGCTGG - Intronic
1129155187 15:73713209-73713231 TGTGAAATAAGGCAGCAGGCAGG - Exonic
1134690093 16:16185278-16185300 TATAAGAAAAGGCAGCAGGCAGG - Intronic
1136854110 16:33639494-33639516 TATTTGCTGAGGCAGCAGACAGG + Intergenic
1137742977 16:50798935-50798957 CATGTCATGAGGCAGCAGGAAGG + Exonic
1139269450 16:65668185-65668207 TACTAAGTGAGGCAGCAGGCTGG - Intergenic
1140667832 16:77244015-77244037 TACTACAAGAGGCTGCAGGCCGG - Intergenic
1141063101 16:80893071-80893093 TACCACACCAGGCAGCAGGCTGG + Intergenic
1142307100 16:89291927-89291949 TTTTAAAAGAGGCAGGAGGCAGG + Intronic
1203115687 16_KI270728v1_random:1487933-1487955 TATTTGCTGAGGCAGCAGACAGG + Intergenic
1142967165 17:3588850-3588872 TAGTATCTGAGGCAGCTGGCTGG - Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1143961514 17:10725010-10725032 TCTTACATGAGGAAGAAGGCAGG - Exonic
1143991837 17:10971013-10971035 TGTCACAAGAGGCAGCAGGGAGG + Intergenic
1148327060 17:46789499-46789521 TATGAGATGATGCAGCAGGAAGG + Intronic
1153466284 18:5391269-5391291 TATTACATGAGTCAGAAACCTGG - Intergenic
1156347169 18:36268177-36268199 TTTTACATCAGGCAGCAAACAGG + Intronic
1156856462 18:41787542-41787564 TATTATCTGAGGTAGGAGGCTGG - Intergenic
1157108047 18:44793225-44793247 TATAAAATGAGGCAGCTGGGTGG + Intronic
1158402995 18:57138137-57138159 TATCAAATGAGGCTTCAGGCTGG - Intergenic
1158447537 18:57534132-57534154 GGTCACATCAGGCAGCAGGCCGG + Intergenic
1160365305 18:78319480-78319502 TATGAAATGAGGCAGAACGCAGG - Intergenic
1161886366 19:6999271-6999293 TAAAAGATGATGCAGCAGGCTGG - Intergenic
1165064941 19:33223619-33223641 GATTACAGCAGGCAGGAGGCTGG - Intronic
1166702179 19:44888585-44888607 TATCTCATGAGGCAGGAGGTGGG + Exonic
1167755287 19:51409267-51409289 TATGAAAATAGGCAGCAGGCTGG + Intergenic
925737197 2:6973768-6973790 TATGAAAACAGGCAGCAGGCTGG - Intronic
931428347 2:62191035-62191057 TATAACAGGAGGAAGGAGGCTGG - Intergenic
943626318 2:190205030-190205052 TATAAAAACAGGCAGCAGGCTGG + Exonic
943961769 2:194273670-194273692 TCTTTCATCATGCAGCAGGCTGG - Intergenic
945352521 2:208798822-208798844 TATGACATGTGGCAGAAGGAAGG + Intronic
946519845 2:220452676-220452698 TATTTCCTAAGGAAGCAGGCAGG + Intergenic
948413744 2:237785117-237785139 TTTTCCCTGGGGCAGCAGGCTGG - Intronic
1172192267 20:33069161-33069183 CATGACAGGAGGGAGCAGGCAGG - Intronic
1177125727 21:17191437-17191459 TGTTACATGAAGCAACAGCCTGG - Intergenic
1177571328 21:22890703-22890725 TCTTGCATGATGCAGCAGGGAGG - Intergenic
1178472534 21:32906167-32906189 AATTCCATAGGGCAGCAGGCTGG - Intergenic
1178860578 21:36285714-36285736 AATTAAAAGAGGCAGGAGGCTGG + Intronic
1178861713 21:36295453-36295475 TCTTCCATCAGGCAGCTGGCAGG - Intergenic
1178932223 21:36829678-36829700 AATTACATGAGGGAGGAGACAGG - Intronic
1179068440 21:38048918-38048940 TCTTACATGTGGCTGCAGCCAGG - Intronic
1180591457 22:16941116-16941138 TATTATTTGAGTCAGTAGGCTGG - Intergenic
1182078806 22:27514348-27514370 TCTTAGATGAGGCAGCAGAAGGG + Intergenic
1183045215 22:35213925-35213947 TTTTTCATGTGGCAGCAGGAAGG - Intergenic
1184647510 22:45904055-45904077 TACTACATGAGGCCCCAGGGTGG - Intergenic
952296569 3:32067845-32067867 TATTTCATGTGGGTGCAGGCAGG - Intronic
952307352 3:32157954-32157976 TATTAAATGAAGCAAAAGGCTGG + Intronic
953752925 3:45623288-45623310 TATAACCAGAGGCTGCAGGCTGG + Intronic
956630505 3:71312324-71312346 TATCATATAAGGCAGCAGGGTGG + Intronic
956681010 3:71780740-71780762 TATTACATGAGGAAGCGGGTGGG - Intronic
958846405 3:99270118-99270140 CATTGCCTCAGGCAGCAGGCTGG + Intergenic
959892290 3:111570407-111570429 TATCTCATGAGGCAGGAGGTGGG - Intronic
960825757 3:121782480-121782502 TATGAAAACAGGCAGCAGGCTGG - Intronic
962145005 3:132831694-132831716 TCTAACATGAGGCAGCAAGCAGG - Intergenic
970992222 4:22225512-22225534 GATTACATGATGCAAAAGGCAGG - Intergenic
973554470 4:52068532-52068554 TATTAGAGGAGGAAGCAGGTGGG + Intronic
974697188 4:65391029-65391051 TTTTTCATAAGGCAGCAGGAAGG + Intronic
981821186 4:148889337-148889359 CATGACACTAGGCAGCAGGCTGG + Intergenic
983651590 4:170041556-170041578 TTTTGCATGAGGTAGAAGGCTGG - Intergenic
984644824 4:182208660-182208682 TATAAAAGTAGGCAGCAGGCTGG + Intronic
985900634 5:2787357-2787379 TATAAAAGTAGGCAGCAGGCTGG + Intergenic
986664843 5:10092711-10092733 TATCAAAACAGGCAGCAGGCTGG + Intergenic
989173875 5:38501069-38501091 TCTTTCATGAGGCTGCAGTCAGG - Intronic
991047762 5:62240683-62240705 TATTTGCTGAGGCAGCAGACAGG - Intergenic
993552574 5:89292234-89292256 AATTACATGTGGCAAGAGGCTGG - Intergenic
995107262 5:108388853-108388875 TATTACATTTGGGAGAAGGCTGG - Intergenic
995801140 5:115996743-115996765 TCTTAGATCAGGCAGCAGGAAGG - Intronic
998970947 5:147592106-147592128 TATTTCATGATGCAGAAGTCTGG + Intronic
999212154 5:149899277-149899299 TATCACATGGGGCAGCAACCTGG - Intronic
1001016509 5:168146487-168146509 TATAAGATGAGCCAGCAGGCAGG - Intronic
1004936324 6:20511924-20511946 TATTTCATGAGGTGGCAGTCAGG + Intergenic
1008999246 6:57694681-57694703 AATGACAAGAGGCAGCAAGCAGG + Intergenic
1012899877 6:104993193-104993215 GATTACATGAGTCACCATGCTGG - Intronic
1014595751 6:123335954-123335976 TATTACATGAGAGTGGAGGCTGG + Intronic
1014835705 6:126158028-126158050 TATTACATATGGCAGAAGGGAGG - Intergenic
1015979240 6:138822253-138822275 CATTACATGGGGAAGGAGGCCGG + Intronic
1017789992 6:157789483-157789505 TACAAAAAGAGGCAGCAGGCTGG + Intronic
1018375444 6:163206540-163206562 GATTACTTGAGGCTGGAGGCTGG + Intronic
1018620846 6:165728098-165728120 GATGACATTGGGCAGCAGGCAGG + Intronic
1019219802 6:170464395-170464417 TCTGCCAAGAGGCAGCAGGCTGG + Intergenic
1019263383 7:95767-95789 TATTACATAAAGCAGCAGCAGGG - Intergenic
1020173448 7:5863826-5863848 TATAACATGAACCATCAGGCCGG - Intergenic
1022478509 7:30727669-30727691 TATTGCTTGAGGCAAGAGGCAGG - Intronic
1038851770 8:31285676-31285698 TACTAAAACAGGCAGCAGGCAGG + Intergenic
1038854632 8:31318014-31318036 TACAACAACAGGCAGCAGGCTGG + Intergenic
1039318921 8:36406692-36406714 TTTAAGAAGAGGCAGCAGGCTGG + Intergenic
1039324866 8:36474309-36474331 TCTTTCATGAGGCTGCAGTCAGG + Intergenic
1041233012 8:55772652-55772674 TACTACATGAGGCTGCAGGGAGG - Intronic
1042064199 8:64856016-64856038 TAACACAGGAGGCAGCAGGACGG - Intergenic
1043805848 8:84671261-84671283 TATTACAGCAGCCAGCAGGGAGG - Intronic
1045574285 8:103402703-103402725 TATTACAACAGGCAAAAGGCTGG + Intronic
1045895346 8:107209644-107209666 AATTAGATGAGGCTGCAGGAGGG + Intergenic
1048008022 8:130434821-130434843 TATCACATGAGACAGGAAGCAGG + Intronic
1048460162 8:134614924-134614946 TATTACATAAGGAAGAAGGTAGG + Intronic
1048687444 8:136919718-136919740 TGTTACATGAAGCAGCAGTCCGG + Intergenic
1053171530 9:35889603-35889625 TAGTAGTTGAGACAGCAGGCAGG + Intergenic
1056442736 9:86636838-86636860 TGTTATCGGAGGCAGCAGGCAGG + Intergenic
1057741012 9:97711190-97711212 AATGTCATGAGGCAGCAGGTGGG + Intergenic
1059553533 9:115254658-115254680 TAAAAAATCAGGCAGCAGGCTGG + Intronic
1059647378 9:116280747-116280769 TATGAAAACAGGCAGCAGGCTGG - Intronic
1060759403 9:126235119-126235141 GATGACATGAGGCAGAAGACGGG - Intergenic
1187147832 X:16653953-16653975 TATTACATGAGGCAGCAGGCAGG - Intronic
1189722712 X:43936794-43936816 TATGACATGGGAAAGCAGGCAGG - Intergenic
1193895524 X:87110333-87110355 TATGACAAGTGGCAGCAGGCTGG + Intergenic
1197211580 X:123832332-123832354 TATTACAAGACCCAGAAGGCGGG + Intergenic
1198565361 X:137898805-137898827 TATTACATGAGGCTGAAGTTTGG + Intergenic
1199883635 X:151996955-151996977 CGTTACATGAGACAGGAGGCAGG - Intergenic
1202096134 Y:21249660-21249682 CAGTACATGAGGCAGGAAGCAGG + Intergenic