ID: 1187156919

View in Genome Browser
Species Human (GRCh38)
Location X:16728740-16728762
Sequence ATAAAGACACAGTTGAGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6502
Summary {0: 1, 1: 1, 2: 39, 3: 779, 4: 5682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187156911_1187156919 28 Left 1187156911 X:16728689-16728711 CCAAAACAAGACAACAATTGTTC 0: 5
1: 31
2: 53
3: 52
4: 274
Right 1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG 0: 1
1: 1
2: 39
3: 779
4: 5682

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187156919 Original CRISPR ATAAAGACACAGTTGAGGCT GGG Intronic
Too many off-targets to display for this crispr