ID: 1187161008

View in Genome Browser
Species Human (GRCh38)
Location X:16765297-16765319
Sequence CTTTATTTATTCAGAAAAAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1095
Summary {0: 1, 1: 0, 2: 6, 3: 108, 4: 980}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187161008_1187161010 -4 Left 1187161008 X:16765297-16765319 CCTTTTTTTCTGAATAAATAAAG 0: 1
1: 0
2: 6
3: 108
4: 980
Right 1187161010 X:16765316-16765338 AAAGCTTACTTTTAGTGGCAAGG 0: 1
1: 1
2: 0
3: 11
4: 186
1187161008_1187161009 -9 Left 1187161008 X:16765297-16765319 CCTTTTTTTCTGAATAAATAAAG 0: 1
1: 0
2: 6
3: 108
4: 980
Right 1187161009 X:16765311-16765333 TAAATAAAGCTTACTTTTAGTGG 0: 1
1: 0
2: 2
3: 31
4: 334
1187161008_1187161012 21 Left 1187161008 X:16765297-16765319 CCTTTTTTTCTGAATAAATAAAG 0: 1
1: 0
2: 6
3: 108
4: 980
Right 1187161012 X:16765341-16765363 TAAGTTATAATGGTTGTTCCTGG 0: 1
1: 0
2: 0
3: 11
4: 150
1187161008_1187161011 11 Left 1187161008 X:16765297-16765319 CCTTTTTTTCTGAATAAATAAAG 0: 1
1: 0
2: 6
3: 108
4: 980
Right 1187161011 X:16765331-16765353 TGGCAAGGTATAAGTTATAATGG 0: 1
1: 0
2: 0
3: 12
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187161008 Original CRISPR CTTTATTTATTCAGAAAAAA AGG (reversed) Exonic
900696202 1:4012062-4012084 CTTTAATTATTTAGAATTAATGG - Intergenic
900890343 1:5444984-5445006 ATTTCTGTACTCAGAAAAAATGG - Intergenic
900985453 1:6070597-6070619 TTTTCTTTATTCAAAAACAATGG - Intronic
901103804 1:6739811-6739833 ATTTATTTTCTCATAAAAAATGG + Intergenic
901794096 1:11670618-11670640 TTTTACTTATTAAAAAAAAAAGG + Intronic
902109036 1:14062474-14062496 CTTTGTTTATTCAGGCAAATGGG + Intergenic
903417667 1:23195272-23195294 TTTTATTTATTTAGCAACAATGG + Intergenic
903452130 1:23461365-23461387 TTTTTTTAATTTAGAAAAAAAGG + Intronic
903598327 1:24514077-24514099 AATGATTTATTAAGAAAAAAAGG - Intronic
904715831 1:32466878-32466900 CTTTGTTAACTAAGAAAAAAAGG - Intronic
905000133 1:34661510-34661532 GTTCATTTAGTCAGAACAAATGG - Intergenic
905616791 1:39406937-39406959 CTTTAATTATTCAGCACAACTGG - Intronic
905804337 1:40864851-40864873 TTTTATTTTTTCAGAAACAGGGG - Intergenic
906052355 1:42886359-42886381 CTCTATTTATTCTGATTAAAGGG - Intergenic
906304940 1:44711668-44711690 ATTTACTTATTCAAAAAGAATGG + Intronic
906413445 1:45599090-45599112 CTTTCTCTATTTAAAAAAAAAGG - Intronic
906582565 1:46948261-46948283 ATTTATTTATTCAAAAACAAAGG + Intergenic
906601047 1:47129607-47129629 ATTTATTTATTCAAAAACAAAGG - Intergenic
906933669 1:50193288-50193310 TTTTATGTATTCAGGAAGAAGGG + Intronic
908029407 1:59983998-59984020 CTTTGTTTCTTCAGCAAAATTGG - Intergenic
908082248 1:60593510-60593532 CTTTATTTATGAAGAAATAAGGG - Intergenic
908213153 1:61922213-61922235 TTTTATTTTTTTAGTAAAAATGG + Intronic
908786909 1:67744180-67744202 CTTTATGTATGGAGAAACAAAGG + Intronic
909055846 1:70820320-70820342 CACTATTTATTCACAAAAAAAGG + Intergenic
909148232 1:71965570-71965592 CTTTATTTATTCATGGAAATGGG + Intronic
909319267 1:74262449-74262471 CTTTATTTGTTCAAATATAAAGG - Intronic
909777517 1:79500888-79500910 CTCTATATAATCAGAAAACATGG + Intergenic
909784059 1:79587339-79587361 ATTTATGTATTCAGAATAATAGG - Intergenic
909854831 1:80515789-80515811 CTTTATTTCTTCTAAAAAAATGG + Intergenic
909891905 1:81017767-81017789 GTTATTTTATTCAGAAAAAAGGG - Intergenic
909930722 1:81496357-81496379 CTTTTTTTCTTTAGCAAAAAAGG + Intronic
910184578 1:84524064-84524086 TTTTATATATTCAAAAGAAAAGG + Intergenic
910223175 1:84909569-84909591 CTTTACTTCTTCTAAAAAAATGG - Intergenic
910597526 1:88995000-88995022 AATTTTTTATTCAGAAAACAAGG - Intergenic
910597530 1:88995033-88995055 AATTTTTTATTCAGAAAACAAGG - Intergenic
910965451 1:92803828-92803850 ATTTATTTGTTTACAAAAAATGG + Intergenic
911288376 1:96026220-96026242 ATTTATTTATTTAGTAAAGACGG - Intergenic
911940034 1:104033776-104033798 ATCCATTTATTCAGAAAAATTGG - Intergenic
912214045 1:107586911-107586933 CTTAATTTGTTCAGAAAATAGGG + Intronic
912238722 1:107882030-107882052 GTTTATTTTTTCAAATAAAAAGG - Intronic
912423293 1:109562972-109562994 CTATATTTATTTAGAGTAAAAGG - Intronic
912771708 1:112470416-112470438 TTTTATATTTTCAGCAAAAATGG - Intronic
913273485 1:117116811-117116833 CTTTTTCTCTTCAGAACAAAGGG + Intronic
913420136 1:118657693-118657715 CTTTATTTTTTCAGAATTAATGG - Intergenic
914805748 1:150990353-150990375 ATTTTTTTTTTCAGAAAAATGGG - Intronic
914834244 1:151194251-151194273 CATTTTTTATTCTGAAAATATGG + Intronic
914920928 1:151847114-151847136 CTTTATTTACTCAGAGAAAAGGG + Intergenic
915006609 1:152644231-152644253 CTTTATTTTTGCAAAGAAAATGG + Intergenic
915036488 1:152931150-152931172 ATTTTTTGAGTCAGAAAAAACGG - Intergenic
915264702 1:154708532-154708554 CTTTATTTAAGAAAAAAAAAAGG - Intronic
915375409 1:155390235-155390257 CTTTAATAATTTAGATAAAATGG + Intronic
915385312 1:155486231-155486253 CTTGATTGACTCAGAATAAAGGG + Intronic
915411340 1:155703215-155703237 CGTAATTTATTAAGAAAAAGAGG + Intronic
915472246 1:156132790-156132812 CTCTATTTATAAAGAAAAACAGG - Intronic
915687305 1:157646323-157646345 CTTTTCTTATTCAGCAAAAGGGG - Intergenic
915803916 1:158824366-158824388 GGTAATTTATACAGAAAAAAAGG - Intergenic
915856141 1:159388106-159388128 ATTAATTTATAAAGAAAAAAAGG - Intergenic
916996415 1:170306558-170306580 TTTTATTAATTCAAAAAAACAGG + Intergenic
916997239 1:170314296-170314318 CTTTATTTATTGAGATGAAAAGG + Intergenic
917542260 1:175925848-175925870 CTTTGTGAATTCAGATAAAAAGG + Intergenic
917614776 1:176730999-176731021 CTTTATTTATTCAGGAATTAAGG + Intronic
917660054 1:177169536-177169558 CTTTATTCATTCAGAACTTACGG + Intergenic
917681252 1:177370260-177370282 CTTTATTTATAAAGAGAAAAAGG + Intergenic
918029887 1:180796566-180796588 ATTTATTCATTCAGCAAACATGG + Intronic
918543963 1:185661454-185661476 CTTTACTCAGGCAGAAAAAAAGG + Intergenic
918686295 1:187419948-187419970 CTTTCTTCATTCAAAGAAAATGG - Intergenic
918869090 1:189943774-189943796 CATTAATTATTCAAAAAAACTGG - Intergenic
919079362 1:192851435-192851457 CTTTCTTTATTCTGAGAAAAAGG + Intergenic
919179284 1:194059976-194059998 CTTAATTTCTTCACCAAAAATGG + Intergenic
919290667 1:195625620-195625642 AGTTATTTATTTAGAGAAAAAGG + Intergenic
919398767 1:197082546-197082568 GTTAATTTATACAGGAAAAAGGG - Intergenic
919407571 1:197203748-197203770 ATTTAGATATTTAGAAAAAATGG + Intergenic
919467931 1:197944745-197944767 CTTCATTTATTCCCAAAAAGAGG + Intergenic
919586078 1:199442197-199442219 CTTTACTTCTTCAAAAAAAATGG + Intergenic
919703612 1:200655794-200655816 CCTTATTTCTTCTGAAAAATTGG + Intronic
920640347 1:207745915-207745937 CTTTATTCCTTCTCAAAAAACGG + Intergenic
920826253 1:209426580-209426602 CTAAATTTGTTCAGAAAAATGGG - Intergenic
921434148 1:215097418-215097440 TTTTTTTTTTTAAGAAAAAAAGG - Intronic
921633510 1:217463952-217463974 TTTTATATACTCAGAATAAAAGG + Intronic
921818216 1:219587669-219587691 ATTTATTTATTTTGAAAAACTGG - Intergenic
923109322 1:230878673-230878695 ATTTATTGATTGAGAAATAAAGG + Intergenic
923279747 1:232432054-232432076 CTTGATTTTTACATAAAAAAAGG - Intronic
923511289 1:234656123-234656145 CTTCATTTAATCACAAAAGAAGG + Intergenic
924525415 1:244842835-244842857 CTTTTTTTATTAGGAAAAAAAGG - Intronic
924766884 1:247041233-247041255 ATTCATTTAAACAGAAAAAAAGG + Intronic
924794461 1:247282988-247283010 CTTTAGACATTCAGAAAAATTGG + Intergenic
1062769362 10:87101-87123 CTTTATTTAAGAAGACAAAAGGG - Intergenic
1062872470 10:917897-917919 ATTTATATCTTCAGTAAAAATGG + Intronic
1062889245 10:1045349-1045371 TATTATTCATTCAGAAATAAAGG - Intronic
1063278058 10:4593118-4593140 GTTTATTTGTTCATAAAATAGGG + Intergenic
1063511786 10:6652279-6652301 ATATATTTATTCAGAAAGAAGGG + Intergenic
1063741544 10:8827324-8827346 CATAATCTATTGAGAAAAAATGG + Intergenic
1064126428 10:12665389-12665411 CCTTATTTAGTTAGGAAAAACGG - Intronic
1064321425 10:14309022-14309044 TTTTATTTTTTCAACAAAAACGG - Intronic
1064361556 10:14670091-14670113 CTTTCTTAATTCATAAAAACTGG + Intronic
1064616355 10:17162403-17162425 ATTCATTTATAAAGAAAAAAGGG + Intronic
1065198349 10:23288580-23288602 TTTTATTTCTTCTAAAAAAATGG - Intronic
1065511916 10:26487932-26487954 CTATATTTATTCTTATAAAATGG + Intronic
1065600355 10:27361719-27361741 CTGTAGTTACTAAGAAAAAATGG - Intergenic
1065793797 10:29286824-29286846 CTTTATATATTCTGAATACAAGG + Intergenic
1065831070 10:29614121-29614143 CTTTAATTTTTTAAAAAAAATGG - Intronic
1065948791 10:30632358-30632380 CTTTATATATTCTGAATACAAGG - Intergenic
1065989811 10:30997549-30997571 ATTTTGTTATTCAGAAAGAAGGG - Intronic
1066134057 10:32425590-32425612 CTTAATTTTTTTAGAAAAGATGG + Intergenic
1066182130 10:32973348-32973370 ATTTAGATATGCAGAAAAAAAGG - Intronic
1066986105 10:42468223-42468245 CTGTATGTATTCACAGAAAAAGG - Intergenic
1067377192 10:45738534-45738556 TCTCATTTATTCAGAAAATATGG + Intronic
1067765544 10:49083098-49083120 CTTTCTTGATTCAGAAAGCAGGG - Intronic
1067884900 10:50079226-50079248 TCTCATTTATTCAGAAAATATGG + Intronic
1068095180 10:52482597-52482619 CTGTATTTATTGAGAACAAAGGG + Intergenic
1068278335 10:54832991-54833013 CTATATTTATGCAAGAAAAAGGG + Intronic
1068361250 10:55976920-55976942 CTTTATTTATTTAGTGAAAGTGG - Intergenic
1068464655 10:57374114-57374136 ATTTTTTTATTATGAAAAAATGG + Intergenic
1068980560 10:63058269-63058291 CTGTATTTATTCAGGGAAATGGG + Intergenic
1069059319 10:63877883-63877905 TTTAATTTTTTCAGCAAAAAGGG + Intergenic
1069281756 10:66663222-66663244 TGTTAATTATTCTGAAAAAAGGG - Intronic
1069376140 10:67794963-67794985 CTAAATTTATTCAGTATAAAGGG - Intergenic
1069400540 10:68040456-68040478 ATTTATCTCTTTAGAAAAAATGG - Intronic
1069644773 10:69986185-69986207 ATTAATTTATTAATAAAAAAAGG + Intergenic
1069644779 10:69986397-69986419 GTTTATATAATTAGAAAAAAAGG + Intergenic
1069975136 10:72206783-72206805 CTTTATTTAATCCAAAACAAAGG - Intronic
1070109662 10:73472695-73472717 CTTTTATTTTTCAGAAAAAATGG - Intronic
1070235893 10:74625892-74625914 ATTTTTTTATTCAAAGAAAAAGG + Intronic
1070310387 10:75269188-75269210 ATTTATTTATTCAAACAAAAGGG + Intergenic
1071377510 10:85023892-85023914 CATTATTTATTCTGAAACACAGG - Intergenic
1072434135 10:95400232-95400254 CTTTAACTATTAAAAAAAAAAGG - Intronic
1072532715 10:96334683-96334705 CTTTTTTCATTCCTAAAAAAAGG + Intronic
1072557728 10:96536029-96536051 CTTTTTTAATTCTGAAAATATGG - Intronic
1073648648 10:105335126-105335148 CTTTCTTTTTTCAAAAAGAAAGG - Intergenic
1073676148 10:105649050-105649072 CTTTATTTATTGGGAAATGATGG - Intergenic
1073763121 10:106652070-106652092 ATTTATGTATTCTGAGAAAATGG + Intronic
1073914501 10:108386488-108386510 CCTTTTTTGTTCTGAAAAAATGG + Intergenic
1074210860 10:111333720-111333742 GTTCTTTTATTCACAAAAAAAGG - Intergenic
1074233717 10:111563589-111563611 TTTTACTTATTCAGATAAAAAGG - Intergenic
1075602748 10:123782564-123782586 CTTTGTCTAATCAGAATAAATGG - Intronic
1076548584 10:131262520-131262542 CTTTAGGTTTACAGAAAAAATGG + Intronic
1076924141 10:133473270-133473292 CTGTAATTTTTAAGAAAAAAAGG - Intergenic
1078001939 11:7503868-7503890 CATTATTCATTCAGAAAATATGG + Intronic
1078203181 11:9203249-9203271 CTTTATATATTGAGAAAATGTGG - Intronic
1078736044 11:14021894-14021916 CTTTATTTGTAAAGAACAAAGGG + Intronic
1079511182 11:21212214-21212236 ATTTATTCATTTAGAAAATAGGG + Intronic
1079658578 11:23012937-23012959 CTTCTTTTATTCAGAGCAAAAGG + Intergenic
1080190605 11:29542702-29542724 TTTTCTTTTTTCAGAAAAAAAGG + Intergenic
1081505139 11:43708535-43708557 ATTTATATGTTCAGCAAAAATGG - Intronic
1081959598 11:47125490-47125512 TTATATTTATTTAGAAAAGAAGG + Intronic
1082628383 11:55512091-55512113 TTTTATTTATTCTCAACAAAAGG + Intergenic
1082755398 11:57070410-57070432 ATTTATTTTTTCAGAGACAAAGG - Intergenic
1082928458 11:58576273-58576295 TCTTATTTATTCAGAAATTATGG + Intronic
1082981629 11:59129193-59129215 ACATTTTTATTCAGAAAAAAAGG + Intergenic
1083052384 11:59788859-59788881 CTTTATTTACCCAGAAACCAAGG + Exonic
1083233472 11:61337689-61337711 TTCAATTTATTCTGAAAAAATGG - Intronic
1084395129 11:68904352-68904374 CCTTATTCATTCAGTAAACATGG + Intronic
1085098471 11:73779922-73779944 ATTTTTATAATCAGAAAAAAAGG - Intergenic
1085720071 11:78904704-78904726 CTTTAATTATTCAGAACACCAGG + Intronic
1085935277 11:81134267-81134289 CTTTACTTTATCAGAAGAAATGG + Intergenic
1085941999 11:81215599-81215621 TTTTATTTATTGAAAACAAATGG - Intergenic
1086199842 11:84188808-84188830 GATTATTTATTTAAAAAAAAAGG + Intronic
1086375225 11:86193541-86193563 CATTATTTTTTTAAAAAAAAAGG - Intergenic
1087621250 11:100545306-100545328 CTGTATTTTTTTAAAAAAAAAGG + Intergenic
1088003717 11:104915013-104915035 ACTTATTTATTAAGAAAGAAAGG - Intergenic
1088007421 11:104959897-104959919 ATTTATTTCTTAAGAAAGAAAGG - Intronic
1088646566 11:111921463-111921485 CTTTATTAAGTTAGTAAAAAAGG + Intronic
1089479557 11:118793022-118793044 CTTTACATATACTGAAAAAAGGG - Intergenic
1090138956 11:124233076-124233098 TTTTCTATATTCACAAAAAAAGG - Intergenic
1090502441 11:127274829-127274851 CTTTCTTTATTCTTATAAAAAGG + Intergenic
1090515572 11:127423229-127423251 CCTTATTTTTTCCTAAAAAAGGG + Intergenic
1090583375 11:128184124-128184146 CTCTATTTCTTCAGATCAAAGGG + Intergenic
1090711050 11:129385674-129385696 ATTTATTTATTAAGACAAAAAGG + Intronic
1092502146 12:9058899-9058921 CTTTCTTTATTCAGTAACACTGG - Intergenic
1092747499 12:11687487-11687509 ATTTTCTTATTAAGAAAAAAAGG - Intronic
1092816604 12:12317956-12317978 CTCTGTTTATTCAAAAATAATGG - Intergenic
1092997191 12:13961569-13961591 ATTTAGTTATTCAGTTAAAATGG - Intronic
1093180232 12:15958912-15958934 GTTTCTTTATTTAGAAAACAAGG - Intronic
1093287143 12:17278064-17278086 GTTTATTTATTGAGAGAACAAGG + Intergenic
1093365421 12:18290152-18290174 CTTTACTTGTTCAAAAAAATTGG + Intronic
1093376764 12:18438106-18438128 ATTAATTTATTGAGACAAAAGGG - Intronic
1093434756 12:19123583-19123605 CATTATTAATTCACAAAATAAGG - Intergenic
1093515972 12:19987321-19987343 CTTAATTTCTTAAAAAAAAAGGG - Intergenic
1093611451 12:21164106-21164128 ATTTATTTTATTAGAAAAAATGG - Intronic
1094370376 12:29731180-29731202 GTTTATTTATTTATATAAAAAGG + Intronic
1094415125 12:30208040-30208062 CTTTTTGTATTGAGAATAAAAGG + Intergenic
1095245573 12:39917282-39917304 CAACATTTATTCAGAAGAAATGG + Intronic
1095258084 12:40064445-40064467 CATTATTTATTGATAAAAGAAGG + Intronic
1095273797 12:40254966-40254988 CTTTATGTTTTTAGAAAAAATGG + Intronic
1095390919 12:41705475-41705497 CTTTATGTAGACAGAAACAATGG - Intergenic
1095457715 12:42406653-42406675 CTTTATATATTCTGAATACAAGG + Intronic
1095517656 12:43024347-43024369 CTTTATTTATTCATTCAAAGAGG + Intergenic
1095728841 12:45482639-45482661 CTGAATTTATAAAGAAAAAAAGG - Intergenic
1095750592 12:45706376-45706398 ATTTATTTATTTTGAAAAACTGG + Intergenic
1096452795 12:51758357-51758379 CTATATTTTTTAAGAAAAACTGG + Intronic
1096671702 12:53202838-53202860 TTTTATTTTTTGAGAAAAAGTGG - Intronic
1097396842 12:59085435-59085457 TTTTTTTTTTTTAGAAAAAAAGG + Intergenic
1097646763 12:62244501-62244523 CATTATTTATTCTGGCAAAATGG - Intronic
1097659278 12:62411110-62411132 ATTTGTTTATGCAGAAATAAGGG + Intronic
1097682764 12:62664271-62664293 GTTTATTAAATTAGAAAAAAAGG + Intronic
1097842521 12:64335710-64335732 CTCTATATATTCAGAAAAGTTGG + Intronic
1097940568 12:65300343-65300365 CTTAATTTAGTCAGAAGATACGG - Intronic
1098296311 12:69007674-69007696 CTTCAGTCATTCAGAAAGAAGGG - Intergenic
1098426620 12:70371570-70371592 CTTTATTTATCTTGAAAAAGTGG + Intronic
1098530185 12:71533027-71533049 ATTTATTTATTTAGAAACGAAGG - Intronic
1098673855 12:73265145-73265167 TTTTATTTGTTTACAAAAAATGG - Intergenic
1098845623 12:75531618-75531640 CTTAATTTCTTCTGAAGAAAGGG + Intergenic
1099221156 12:79916410-79916432 CTTTATACATTCATAAAGAATGG + Intronic
1099287588 12:80733789-80733811 CTTTATTAATCAAGATAAAATGG + Intergenic
1099661109 12:85563446-85563468 CATTATCTAATCAGAAAAGAAGG + Intergenic
1099789081 12:87307613-87307635 CTTTTTATATTCACATAAAAAGG - Intergenic
1099950896 12:89302883-89302905 TTTTTTTTTTTAAGAAAAAAAGG + Intergenic
1100152687 12:91759873-91759895 GCTTATATATACAGAAAAAAAGG + Intergenic
1100178347 12:92056625-92056647 GTTTATTTCTTAAAAAAAAAAGG + Intronic
1100928898 12:99583971-99583993 CTTCATTTTTTCAGAAAAATGGG - Intronic
1101006714 12:100407983-100408005 CTGTATTTAAGCAGAAAAAGTGG - Intronic
1101157573 12:101942289-101942311 CTTTATTTGATCACATAAAATGG - Intronic
1101663813 12:106790973-106790995 CTTTATATTTTCAGCAAAATAGG + Intronic
1101949251 12:109161953-109161975 CTTCATTTATTTACAAAAAAAGG - Intronic
1102067522 12:109989644-109989666 TTTTATTTCTTCATAACAAATGG - Intronic
1102274852 12:111573876-111573898 TTTTTTTTTTCCAGAAAAAATGG + Intronic
1102838506 12:116091356-116091378 TTTAAGTTATTAAGAAAAAAAGG + Intronic
1102843316 12:116149986-116150008 ATTTATTCATTCATTAAAAATGG - Intronic
1103061925 12:117865383-117865405 CGTCATTTATTCAGAAGAAAAGG - Intronic
1103139969 12:118540028-118540050 ATTTATTTATTAAGAAATACAGG + Intergenic
1103311283 12:120010923-120010945 ATTTACTGATTAAGAAAAAAAGG + Intronic
1104075494 12:125385946-125385968 CTTGTTTAATTCACAAAAAATGG - Intronic
1104255823 12:127137299-127137321 CTTTGTTTCTTCTAAAAAAATGG + Intergenic
1104541115 12:129665505-129665527 CTTTTTTTTTTCAGTCAAAAAGG + Intronic
1105388389 13:19953873-19953895 ATTTATTTATTTAAAAAGAAGGG + Intergenic
1105533455 13:21241961-21241983 CTTCTATTATTCAGGAAAAAAGG + Intergenic
1105740543 13:23318567-23318589 ATTTACCTATTCAGAAAAGAGGG + Intronic
1106752155 13:32785441-32785463 CTTTATGTATGCTGAAAAGAAGG + Intergenic
1106911507 13:34468060-34468082 CTTTATTTCTTTAGTAAAGATGG - Intergenic
1107362408 13:39634004-39634026 ATGTATTTCTTCAGAAATAAAGG + Intergenic
1107703485 13:43074414-43074436 GTTTCTGTTTTCAGAAAAAAAGG + Intronic
1107726218 13:43302365-43302387 ATGTATTTATTAAGAAAACATGG + Intronic
1108321156 13:49291819-49291841 CCTTGTTCATTCAGAAAATAAGG + Exonic
1108844145 13:54658332-54658354 CTCTACTTATTCAAAGAAAAAGG - Intergenic
1108853966 13:54770830-54770852 CATTATTCATTCAGAAAAAGAGG + Intergenic
1109149574 13:58829114-58829136 CTTAATTTGTACAGAAATAAGGG + Intergenic
1109246059 13:59956030-59956052 TTTTATTCATTCAGAAGATATGG + Intronic
1109661063 13:65461444-65461466 TTTTTTTTTTTCAGGAAAAATGG - Intergenic
1109684748 13:65803399-65803421 CTGTATTTATTCATAAAGATGGG - Intergenic
1109756488 13:66767720-66767742 TTTTATTACTTCAGGAAAAAAGG - Intronic
1109812889 13:67538708-67538730 CTTTATTTCTTAAGAATAAGAGG - Intergenic
1109830131 13:67774981-67775003 CATTATTTTTATAGAAAAAAAGG - Intergenic
1110100904 13:71600292-71600314 TTATATTCATTCAGAAATAATGG + Intronic
1110222321 13:73086606-73086628 CTTTATTTCTCCAGAGAAAAGGG + Intergenic
1110339576 13:74373739-74373761 TTTTTTTTTTTCAGAAATAACGG + Intergenic
1110455956 13:75690492-75690514 CTTTATTTATTCAAATACATTGG - Intronic
1110464465 13:75785053-75785075 CTAAATTTTGTCAGAAAAAATGG + Intronic
1110498844 13:76202084-76202106 TTTTATTTCTTCTAAAAAAAAGG + Intergenic
1110913651 13:80994849-80994871 ATTTACTTCTTCAAAAAAAAAGG + Intergenic
1111059427 13:82994509-82994531 CTTTATATACTCAGCAACAAAGG - Intergenic
1111352458 13:87049019-87049041 CTATATTTATCAAAAAAAAATGG + Intergenic
1111427038 13:88099881-88099903 ATTTATTTTATCAGAAAACAAGG - Intergenic
1111692921 13:91587381-91587403 CTATATTTATGCATAAAATAAGG + Intronic
1111736336 13:92144512-92144534 CATTATTTGTTCAGAAACAAAGG + Intronic
1111768688 13:92568596-92568618 ATATATTTATTCAAAACAAATGG - Intronic
1111962167 13:94823679-94823701 CTTTATTGATGAAGAAAAACTGG - Intergenic
1112503956 13:99963183-99963205 GTTTATTTATTATGAAACAAAGG - Exonic
1113284704 13:108833943-108833965 CTTTATTTGGTGAGAAAAAATGG - Intronic
1114767925 14:25395478-25395500 GTTCATTTATTCATGAAAAAAGG - Intergenic
1114785177 14:25588491-25588513 CATTATTTATTTAGAAAGATAGG - Intergenic
1114917144 14:27282708-27282730 CTTTATTTAATCAGTACACAGGG + Intergenic
1114926538 14:27407696-27407718 CATTATTTATGAAGAAAATAGGG + Intergenic
1114963544 14:27926761-27926783 ATTTATTTATCCAAAAAACAAGG + Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115418646 14:33166609-33166631 CTTTACTCTTTCAGATAAAAGGG - Intronic
1115582366 14:34773920-34773942 ATTTATTTATACAGAAAGTAAGG - Intronic
1115796789 14:36945906-36945928 CTTTATTTAATGAAGAAAAAAGG + Intronic
1115848563 14:37567061-37567083 CTTTATTTCTTCGGAGAAGATGG - Intergenic
1115918463 14:38343509-38343531 CTTTATTTTTCCAAAACAAATGG - Intergenic
1116621704 14:47212264-47212286 CTTTATTTATTCATAAGAATTGG - Intronic
1116662200 14:47724922-47724944 CTTGATTTATTTAGACAAATAGG - Intergenic
1116684491 14:48019966-48019988 CTTTCTTCATTAAGAAAATAAGG - Intergenic
1117111476 14:52460725-52460747 CTTTATTTGTTGATTAAAAAAGG + Intronic
1117407244 14:55416290-55416312 CTTAATTTTTTAAGAAATAAGGG + Intronic
1117537033 14:56712362-56712384 TTTAATTTTTTCAGCAAAAAAGG + Intronic
1117939192 14:60942674-60942696 ATTTTTTTATTCATAAAAATGGG - Intronic
1118101403 14:62608068-62608090 CATTATTTTCACAGAAAAAAAGG + Intergenic
1118108140 14:62684350-62684372 CTTTTTTTTCTGAGAAAAAAAGG - Intergenic
1118523458 14:66614747-66614769 CTTTATTTCTTGTAAAAAAATGG + Intronic
1118581602 14:67305811-67305833 CATTATTGATTAAGAATAAAAGG + Intronic
1118582945 14:67322723-67322745 TCTTATTTCTCCAGAAAAAAGGG + Intronic
1118965969 14:70585784-70585806 CTATAATTTTTTAGAAAAAAGGG + Intronic
1119012093 14:71004082-71004104 TTTTATTTATTTACAAAAACAGG - Intronic
1119807548 14:77491999-77492021 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1119896067 14:78220874-78220896 TTTTTTTTTTTCAGTAAAAAAGG + Intergenic
1119976483 14:79029850-79029872 ATTTATTTATTTATAAAACAGGG + Intronic
1120006203 14:79360651-79360673 ATTTATTTATTCTTTAAAAATGG + Intronic
1120043262 14:79777648-79777670 ATTTATTTATTCACAAACACTGG + Intronic
1120343163 14:83247205-83247227 ATTATTTTATTCAGGAAAAATGG + Intergenic
1120353465 14:83395241-83395263 CTTTATTTTTTCTGATACAAAGG + Intergenic
1120507150 14:85366833-85366855 GTTTATTTTTCCAGAAGAAATGG - Intergenic
1121070169 14:91011882-91011904 TTTTTTTATTTCAGAAAAAAAGG + Intronic
1121103128 14:91263867-91263889 ATTCATTTATTCAGCAAAACGGG - Intergenic
1121316350 14:92963237-92963259 CTTTATTGAACCAGAAAAAATGG - Intronic
1122061032 14:99136831-99136853 CTTTTTTAGTTCAGAAAATATGG + Intergenic
1122434338 14:101684015-101684037 CTTTATTTATTTACACAACAGGG - Intergenic
1123192261 14:106582708-106582730 ATGCATTTATTCAGAAGAAATGG + Intergenic
1123905806 15:24920228-24920250 CGTTTCTGATTCAGAAAAAAAGG - Intronic
1124044573 15:26137154-26137176 TACTATTTATTCAGTAAAAATGG + Intergenic
1124156660 15:27232127-27232149 ATTAATTTTTTCAGGAAAAATGG + Intronic
1124906983 15:33878513-33878535 ATTTAAGTGTTCAGAAAAAAAGG + Intronic
1124966868 15:34438466-34438488 TATTATTTATTCAAAGAAAATGG + Intergenic
1125188730 15:36964599-36964621 CCATATTGATTCAGAAAGAAGGG + Intronic
1125236961 15:37525711-37525733 TTTTTTTTTTTTAGAAAAAAAGG + Intergenic
1126247715 15:46528488-46528510 ATTTCTTTATCCAGACAAAATGG + Intergenic
1126928082 15:53613458-53613480 CTTTCTTCATTTAGAAAATAAGG - Intronic
1127070662 15:55285756-55285778 ATTTATTTATTCAATAGAAACGG - Intronic
1127161868 15:56196785-56196807 CTTTATTTATTCTTTAATAATGG + Intronic
1127710120 15:61588923-61588945 TTTTATTTCTTCTGAAAAAATGG - Intergenic
1127763246 15:62162189-62162211 ATTTATTTATTTAGTAGAAATGG - Intergenic
1127833790 15:62773637-62773659 CTTTATTTCTTCTGCAAACAGGG - Intronic
1128278581 15:66375345-66375367 ATTTATTTATTTAGAGACAAGGG + Intronic
1128999756 15:72322194-72322216 ATTTATTCATTTAGTAAAAATGG - Intronic
1129424235 15:75452982-75453004 TTTTATTTATTCACCAAATAGGG + Intronic
1129821512 15:78605247-78605269 CTAAATTTCTTCAGAAAAATAGG + Intronic
1130043429 15:80425576-80425598 TTTTATTTTTTCCAAAAAAATGG + Intronic
1131868624 15:96738521-96738543 CTTTAAGTATTCTGAACAAAGGG - Intergenic
1131901211 15:97089767-97089789 ATTTCTTTTTTAAGAAAAAACGG - Intergenic
1131914717 15:97252153-97252175 GGTAATTTATACAGAAAAAAAGG - Intergenic
1132068486 15:98753229-98753251 CTTTATTTAAAAAAAAAAAAAGG - Intronic
1132240224 15:100252173-100252195 TTTTATATATTCAAAAGAAACGG + Intronic
1132632267 16:924408-924430 TTTTAATTATTAAAAAAAAATGG - Intronic
1133831359 16:9326388-9326410 CATTATTTATAAAGAAAAAGAGG + Intergenic
1135265151 16:21019074-21019096 CTTTTTTAATTTAGAAAAAGAGG - Intronic
1135285651 16:21190587-21190609 CTGTATTTATTCACAAAGTAAGG + Intergenic
1135418598 16:22288698-22288720 CTTTATTTGTAAAGAGAAAATGG - Exonic
1136286325 16:29245395-29245417 TTTTATTGATTTAAAAAAAAAGG - Intergenic
1136406644 16:30052064-30052086 CTCTAAAAATTCAGAAAAAAAGG + Intronic
1136663445 16:31786174-31786196 CTTTTCTAATTCTGAAAAAAAGG + Intronic
1137238656 16:46636443-46636465 CTTTTTTTAATTAAAAAAAAAGG + Intergenic
1137411255 16:48230244-48230266 CATTATTTATTCATACAGAAAGG - Intronic
1138389515 16:56659900-56659922 ATTTATTTATTTAGAGACAAGGG - Intronic
1138694909 16:58804036-58804058 CTTTTTCTCTTCAGAACAAAGGG - Intergenic
1138701222 16:58865659-58865681 CTTCATATATTCTCAAAAAACGG - Intergenic
1138784014 16:59824421-59824443 CTTTATCTGTTCAGTAAAAGAGG + Intergenic
1139098224 16:63732102-63732124 TTGTATTTATTGAGAAATAACGG + Intergenic
1139169098 16:64609576-64609598 CTTTAGTTCTTCTAAAAAAATGG + Intergenic
1139459115 16:67108215-67108237 TTTTGTTTTTACAGAAAAAAAGG + Intergenic
1139790131 16:69427296-69427318 CTTGATTGATTCAGAATAGATGG + Intronic
1140117321 16:72053875-72053897 GTTGATTTATTCATTAAAAAGGG - Intronic
1140441606 16:74992122-74992144 CTTTCACTATTCAGAAAATAGGG - Intronic
1140691635 16:77490154-77490176 CTTTTTTCATTCAGCAAATAGGG + Intergenic
1140887230 16:79255432-79255454 TTTTATTCATTCTGAAAAGAAGG - Intergenic
1140889833 16:79275674-79275696 CTTTTTTTATTTGGAAAATATGG + Intergenic
1141588098 16:85048529-85048551 CTTTGTTTTTTGAGAAAAAAAGG - Intronic
1142091676 16:88215692-88215714 TTTTATTGATTTAAAAAAAAAGG - Intergenic
1143828551 17:9632386-9632408 CCTTTTTTATTTAAAAAAAAAGG - Intronic
1144143849 17:12378021-12378043 TTTTTTCTAATCAGAAAAAACGG + Intergenic
1144339444 17:14300147-14300169 TTATATCTATTCAGGAAAAAGGG + Intergenic
1144348183 17:14368749-14368771 CTTTATTTGCTCAGAAATGAGGG + Intergenic
1144502977 17:15805702-15805724 CTTTATTTTTACAGAATAACAGG + Intergenic
1144561915 17:16327791-16327813 ATATATTTATTCAACAAAAATGG - Intronic
1145165163 17:20608404-20608426 CTTTATTTTTACAGAATAACAGG + Intergenic
1146987460 17:37234032-37234054 TTTTATTTCTTCAGAATGAAGGG - Intronic
1147033520 17:37661667-37661689 ATTTCTTTATTCATAAAATAAGG + Intergenic
1147357752 17:39910995-39911017 TTTAATTTATTAATAAAAAAGGG + Intronic
1147438819 17:40434515-40434537 TTTTTTTTTTTCAGTAAAAATGG + Intergenic
1147532318 17:41291024-41291046 CTCTCTTTATTCAGATCAAAAGG - Intergenic
1147917162 17:43895423-43895445 TTTTATTTCTTAAGAAGAAATGG + Intronic
1148036487 17:44666309-44666331 CTTTATTTCTTCAGTGGAAAAGG - Intronic
1148098629 17:45072857-45072879 CTTTTTTTATTAAAAAAAATAGG - Intronic
1148186830 17:45650506-45650528 CATTATTTATTCAACAAACACGG + Intergenic
1148513508 17:48193999-48194021 TTTGATTTATTGAGAATAAATGG + Intronic
1148664963 17:49367577-49367599 CTTTATTCATTCTGTAAAAGGGG - Intergenic
1148999707 17:51744605-51744627 ATTTATTTATTTAGAGAGAAAGG - Intronic
1149200133 17:54176124-54176146 AGTTTCTTATTCAGAAAAAAAGG - Intergenic
1149616320 17:58003509-58003531 GTTTATTTTTTCAAAGAAAACGG + Intronic
1149959678 17:61094348-61094370 TTTGTTTTATTCAGATAAAATGG - Intronic
1150189195 17:63219788-63219810 TTTTATTTCTTCTAAAAAAATGG - Intronic
1150365438 17:64578690-64578712 TTTTATTTATTATCAAAAAAGGG + Intronic
1150675300 17:67240864-67240886 TTTTAATTATTCAAAAGAAATGG - Intronic
1151043327 17:70890056-70890078 TTTTATTTTTTGAGAAAAATGGG + Intergenic
1152066021 17:78112932-78112954 CTCTATTTATTCTGATTAAAGGG - Exonic
1152893874 17:82898566-82898588 TTTTATTGATTCAGAAGAACTGG + Intronic
1153179253 18:2414435-2414457 CTTTATTAATTCAGCACAAATGG + Intergenic
1153357554 18:4154330-4154352 TTTTTTTTATTTAAAAAAAAAGG - Intronic
1153376809 18:4390191-4390213 ATTTATTAATTAAGAAAAAAGGG - Intronic
1153389342 18:4536160-4536182 CTTTATTGAGCCAGCAAAAAAGG + Intergenic
1153780984 18:8495000-8495022 GGTTATTTATTGTGAAAAAATGG + Intergenic
1153806885 18:8716639-8716661 CTGTATTTATTCTTAAAAACAGG - Intronic
1155099508 18:22595498-22595520 GGTAATTTATTCAGAAAATAGGG - Intergenic
1155323540 18:24643334-24643356 CTTTATTTTTACTGAAAATAAGG - Intergenic
1155600457 18:27540082-27540104 CTTTATTTTTTCAAATGAAAAGG + Intergenic
1155732202 18:29174637-29174659 CTTTATTTAATAGGAAAATAGGG - Intergenic
1155752499 18:29443821-29443843 CTGAATTCATTCAGGAAAAAAGG + Intergenic
1155816160 18:30313554-30313576 CTTTCTTTTTTCAAAAAAATTGG + Intergenic
1156178493 18:34575545-34575567 CTTAATTTACATAGAAAAAAAGG - Intronic
1156518716 18:37703139-37703161 ATTTAGATATGCAGAAAAAAAGG - Intergenic
1156526766 18:37775265-37775287 CTTTATTTATTGAGCAGATAGGG + Intergenic
1156659646 18:39331838-39331860 CTTTGTTTATTTAGAAAATTTGG + Intergenic
1156838529 18:41584289-41584311 ATTTATGTATTTAAAAAAAAAGG - Intergenic
1156871537 18:41951496-41951518 CATTTTTTAATTAGAAAAAAAGG + Intergenic
1157000848 18:43522561-43522583 TTTTCTTTATTCAGAAGAAAGGG + Intergenic
1157054515 18:44210707-44210729 CTTTGTTGATTCAGAAGTAAGGG - Intergenic
1157135129 18:45046542-45046564 GTGTATTTATTCAGAGAAGAAGG + Intronic
1157147393 18:45177822-45177844 ATTTATTCATTCAAAACAAATGG - Intergenic
1158182791 18:54736461-54736483 CTTCATTTAGTAAAAAAAAAAGG + Intronic
1158386616 18:57000347-57000369 CCTTTTTTATTAAGAAAAACAGG - Intronic
1158409239 18:57189896-57189918 CTCTGTTTATTCTGAGAAAATGG - Intergenic
1158789515 18:60760896-60760918 CTTTATTTTTTCTTAAAACAAGG + Intergenic
1159227169 18:65554581-65554603 CTTTATTTCCTCAGAAATGAAGG + Intergenic
1159401908 18:67949197-67949219 CTTCATTTAGTGAAAAAAAAAGG - Intergenic
1159590833 18:70333391-70333413 CTTTATTAATTCAGAATTATGGG - Intergenic
1159688047 18:71448010-71448032 ATTTATTAATTCACAATAAAAGG - Intergenic
1159735218 18:72088424-72088446 CTTTATGTATTCAGAAAATATGG + Intergenic
1159872633 18:73775763-73775785 TTTTATTCATTGGGAAAAAAAGG + Intergenic
1159969608 18:74633240-74633262 CTTTATTCATTGAGCAAAGAAGG + Exonic
1160482062 18:79250593-79250615 CTTGAATTATTGAGAAAAATAGG - Intronic
1162659145 19:12156146-12156168 ATTTAGTTTTTCAGGAAAAAAGG + Intronic
1163816618 19:19469506-19469528 CTTTATTCACTGAGAAATAAAGG + Intronic
1163952367 19:20601577-20601599 ATTTATATTTACAGAAAAAAAGG + Intronic
1164137194 19:22426371-22426393 TTTTATTTAATCAAGAAAAAAGG + Intronic
1164160993 19:22625263-22625285 TTTTATTTAATCAAGAAAAAAGG - Intergenic
1164749422 19:30641139-30641161 TTTTACTTTTTCACAAAAAATGG + Intronic
1164806951 19:31124306-31124328 ATTTATTTATTTAGTAAAGACGG - Intergenic
1164948652 19:32317744-32317766 CTTTTTCTTTTAAGAAAAAAGGG - Intergenic
1164955723 19:32382014-32382036 CTTTATAGATCCACAAAAAATGG - Intronic
1164967571 19:32498749-32498771 TTTTCTTTAGTCAGAAATAATGG + Intergenic
1164970020 19:32523873-32523895 TTTTAGTTATTGATAAAAAATGG + Intergenic
1166619211 19:44280607-44280629 CATAATTTATACAGGAAAAAGGG - Intronic
1167073976 19:47237802-47237824 GTTTATTTATTTATAAAACAGGG - Intergenic
1168417560 19:56178641-56178663 CCTTAGTTATATAGAAAAAAAGG - Intronic
924970260 2:119747-119769 CTTTTTGTATTCACAAGAAAGGG + Intergenic
924975125 2:166372-166394 CTATGTTTATTCTGAATAAAGGG - Intergenic
925502455 2:4521353-4521375 GTTTCTTTATTCATAAAATAGGG - Intergenic
925517718 2:4703380-4703402 CTTTATTCATATAGAAAACAAGG - Intergenic
925627337 2:5854311-5854333 TTTTATTTTTTTAGAAAATAGGG + Intergenic
925686348 2:6477366-6477388 TTTTATATTTTCAGAAAATATGG + Intergenic
925717366 2:6796669-6796691 CTGTATTTTCTCAGAAACAAAGG + Intergenic
925959475 2:9002679-9002701 CTTTCTTTTCTCAGTAAAAATGG + Intronic
926316186 2:11711966-11711988 CATTATGTAATTAGAAAAAAGGG - Intronic
926657376 2:15423164-15423186 CTTTATCTATTTATAAAATACGG + Intronic
927374142 2:22393732-22393754 CTTTATTTATACAGAAACCTGGG - Intergenic
927842204 2:26452725-26452747 CTTTATGTATTCACATGAAAAGG + Intronic
928235888 2:29539506-29539528 CTTTGATTATTCTCAAAAAAAGG + Intronic
928248844 2:29656911-29656933 CTTTATATAAGCAGGAAAAAAGG - Intronic
929069797 2:38018728-38018750 CTTTATTTATTATTAAAAACTGG - Intronic
929203174 2:39259764-39259786 CTTTTTTTCTTCAAACAAAAGGG - Intronic
929218957 2:39443754-39443776 CAATATTTATTTACAAAAAAGGG + Intergenic
929310092 2:40413524-40413546 CCTCCTTTATTAAGAAAAAAGGG - Intronic
929371278 2:41226471-41226493 CTTTATTTCTTCTAAAAAAATGG - Intergenic
929658460 2:43757767-43757789 CTTTCTTTAATTAAAAAAAAAGG + Intronic
929863138 2:45696349-45696371 ATTTATTTAATTATAAAAAAAGG - Intronic
929900900 2:46002570-46002592 CTTTGCTTATTGAGAAAACAGGG - Intronic
930547173 2:52783041-52783063 TCTTAATTATTCAGAAAGAATGG - Intergenic
930788641 2:55299441-55299463 CTTAATTTATCCACAAAATAAGG - Intronic
930952260 2:57157106-57157128 GCTAATTTATACAGAAAAAAAGG + Intergenic
931333228 2:61310774-61310796 TTTTATATTCTCAGAAAAAATGG + Intronic
931821896 2:65960548-65960570 CTTAATTTCTTTACAAAAAAAGG - Intergenic
931956374 2:67430435-67430457 CTTTTTTTTTTCAATAAAAAAGG + Intergenic
932018431 2:68057461-68057483 CTTTTTTTCTTCAAAATAAATGG - Intronic
932305833 2:70703738-70703760 CTATATATGTTAAGAAAAAAAGG + Intronic
932566053 2:72910356-72910378 TTTTTTTTTTTCAGAAGAAAGGG + Intergenic
932813521 2:74843721-74843743 CTTTATTCCTTCAGACAATATGG - Intronic
932941212 2:76168759-76168781 CTTTCTTTCTTCAGAATAAAAGG - Intergenic
932941444 2:76171566-76171588 CTTTATTTCTTCTAAAAAAATGG + Intergenic
932970316 2:76533039-76533061 ATTTCTTAATTCAGAAGAAAGGG + Intergenic
933049153 2:77580457-77580479 TTTTATTTATCCATAAATAAAGG - Intronic
933322562 2:80795408-80795430 GTTTATTTATTCCTAAAACAGGG + Intergenic
933457899 2:82540458-82540480 CTTTATTTATTCAGTTGCAAAGG + Intergenic
933528276 2:83472237-83472259 CTTTATTTTCTTTGAAAAAATGG - Intergenic
933542418 2:83664395-83664417 ATTTATTTATTCATATACAAAGG - Intergenic
933764977 2:85701063-85701085 CTGAAATGATTCAGAAAAAAAGG + Intergenic
933906032 2:86893393-86893415 AGTTATTTATACAGAAACAATGG - Intergenic
934017005 2:87898813-87898835 GGTAATTTATACAGAAAAAAAGG - Intergenic
934019173 2:87926602-87926624 CTTCATTTCTTCTAAAAAAATGG - Intergenic
934127426 2:88910801-88910823 CTTTATTTCTTCTTAAAAATGGG - Intergenic
934682242 2:96292745-96292767 CTTTAAAAATTCAGAAGAAATGG - Intronic
934869367 2:97847255-97847277 CTGTTTTTATTCAGATAACATGG + Intronic
935766876 2:106376563-106376585 AGTTATTTATACAGAAACAATGG - Intergenic
935817355 2:106859172-106859194 CTTTATTTAATCACCTAAAAGGG + Intronic
936366131 2:111858266-111858288 AGTTATTTATACAGAAACAATGG + Intronic
936588224 2:113777469-113777491 CTTTATTTATGTAAGAAAAAAGG - Intergenic
936833099 2:116672848-116672870 TTTTCTTTGTTCAGAAAATATGG - Intergenic
937429360 2:121825533-121825555 TTTTATTTGTTCAGCAAACATGG + Intergenic
937724439 2:125145102-125145124 GTTTATTTATTTTTAAAAAATGG + Intergenic
938033345 2:128014635-128014657 TTTTATTTAAAAAGAAAAAAAGG - Intronic
938372159 2:130776972-130776994 CTTTATTTATTACAAAACAAAGG + Intergenic
938626488 2:133114697-133114719 CTTTATTTGTTGAAAAAAACAGG + Intronic
939118096 2:138084565-138084587 CTTCCTTTGTTAAGAAAAAAAGG - Intergenic
939572057 2:143852122-143852144 CTTCAGTTTTACAGAAAAAATGG - Intergenic
940076267 2:149745664-149745686 TTTTATTTTTTCAATAAAAATGG + Intergenic
940168029 2:150796537-150796559 CTTTATTTCGTCTAAAAAAATGG - Intergenic
940759561 2:157722468-157722490 CTTTTTTTTTTTAAAAAAAAAGG + Intergenic
941082950 2:161083298-161083320 CTTTATATATAAAGAAGAAAAGG + Intergenic
941094633 2:161223523-161223545 CTTTTGATATTCAGTAAAAATGG - Intronic
941217461 2:162731015-162731037 CTTTATTTTATCAGAGCAAAAGG + Intronic
941298301 2:163768686-163768708 GTTTGTTTTGTCAGAAAAAAAGG + Intergenic
941449862 2:165646831-165646853 CTTTTTTTATTGGGAAAAAAAGG - Intronic
941675442 2:168339180-168339202 CTTAATTGATCCAGGAAAAAAGG + Intergenic
941810839 2:169754673-169754695 GATAATTTATTAAGAAAAAAAGG - Intronic
942118301 2:172750270-172750292 GTTAATTTATAAAGAAAAAAAGG + Intronic
942464440 2:176192658-176192680 CTTTATTTTCTCAGAGAAAAGGG - Intergenic
942509516 2:176682513-176682535 TTTTTTTTATTTAGAAAAATGGG - Intergenic
942949449 2:181705630-181705652 ATTAATTTTTTCAGAAAAACAGG - Intergenic
943176093 2:184476424-184476446 ATTTAGTTTTTTAGAAAAAATGG - Intergenic
943243210 2:185413875-185413897 TTTTATTTCTTCTAAAAAAAAGG - Intergenic
943258158 2:185623949-185623971 CATTATTTATGCCCAAAAAATGG + Intergenic
943782452 2:191839303-191839325 CTTTATTTAATCCCAACAAAAGG + Intronic
944317485 2:198298546-198298568 TTTAAATTCTTCAGAAAAAAAGG - Intronic
944354678 2:198773038-198773060 TTTAATTTATTAAGAAGAAATGG - Intergenic
944864157 2:203844823-203844845 ATTTATTTATTTAGTAGAAACGG + Intergenic
945150751 2:206788202-206788224 ATTTTTTTGGTCAGAAAAAAAGG - Intronic
945535189 2:211008341-211008363 CTTTTTTTATGCAGAGAGAATGG - Intergenic
945655944 2:212624261-212624283 TTTTTTTTAATCAGGAAAAAAGG + Intergenic
945666227 2:212746766-212746788 TTTTATGTATTCTGAAACAAAGG + Intergenic
945751674 2:213793444-213793466 ATTTATTTATTCAGAGTAACTGG - Intronic
945854688 2:215054848-215054870 ATATTTTTATTCAGAGAAAATGG + Intronic
946115130 2:217454667-217454689 CTGACTTTATTCAGAAATAATGG + Intronic
946211591 2:218151679-218151701 CTTCATTTATGAAAAAAAAATGG - Intergenic
946344451 2:219097364-219097386 CTGTATTTATTTTGAAAGAAGGG + Intronic
947086664 2:226460614-226460636 GGTAATTTATACAGAAAAAAGGG + Intergenic
947929434 2:233951418-233951440 CTTAATTTATTCACCAAAGATGG + Intronic
948417285 2:237819835-237819857 CCTTATTTATCCAGAATCAATGG - Intronic
948500661 2:238390959-238390981 TTTTCTTTTTTGAGAAAAAAGGG + Intronic
948689384 2:239692275-239692297 CCTTATTTATTCAGGGAATAGGG - Intergenic
948725647 2:239932192-239932214 CTTTATATTTTGCGAAAAAATGG + Intronic
1169243411 20:4004494-4004516 CTTTATTTAAGAAAAAAAAAAGG + Intronic
1169284891 20:4299710-4299732 GCTTCTTTATTCAGAAGAAAAGG - Intergenic
1169519769 20:6358201-6358223 CTATACTTATTCTGAAAATATGG + Intergenic
1169603891 20:7293664-7293686 CTTTATTTTTTTTTAAAAAAAGG + Intergenic
1169609150 20:7359757-7359779 TTTGACTTGTTCAGAAAAAAAGG + Intergenic
1169620357 20:7499667-7499689 CTCTATTTATTCACAATAATGGG + Intergenic
1169744697 20:8931813-8931835 TTTCCTTTTTTCAGAAAAAAGGG + Intronic
1170243671 20:14196780-14196802 CTTTCTAAATTCAGAAAATATGG + Intronic
1170389885 20:15860693-15860715 CTTTATTCCTTTAGAAAGAAAGG - Intronic
1170915272 20:20617811-20617833 CTTTGTTTATTAAGAAAAAGGGG - Intronic
1171126803 20:22609770-22609792 ATTTATTTATTCATTTAAAATGG + Intergenic
1171146927 20:22792895-22792917 CTGTTTTTATTCATACAAAATGG + Intergenic
1171750563 20:29044642-29044664 CCCTATTTATTTAAAAAAAAAGG + Intergenic
1173033859 20:39389850-39389872 TTTCATTTATACTGAAAAAAAGG + Intergenic
1173055759 20:39611034-39611056 CTTTATTTCTTCTAAAAAAATGG - Intergenic
1173097336 20:40048061-40048083 CTTGATTTTTTCAGAATAAATGG - Intergenic
1173153013 20:40583978-40584000 CTATATTTATACAGAAAAAGTGG - Intergenic
1173196608 20:40919309-40919331 CTTTATTTTTTTAAAAAAAAAGG + Intergenic
1173454990 20:43194813-43194835 TTTTTTTTAAACAGAAAAAATGG - Intergenic
1174753334 20:53133958-53133980 TTTTTTTTTTTCAGAAAAAATGG - Intronic
1174993437 20:55539202-55539224 CTTAATTTTTTCAAACAAAAAGG - Intergenic
1176314644 21:5231274-5231296 CCCTATTTATTAAAAAAAAAAGG - Intergenic
1176691909 21:9922576-9922598 CTTTATTTTTTCAAATAAGATGG + Intergenic
1177158761 21:17525016-17525038 CTTGATCTATTGATAAAAAAAGG + Intronic
1177401982 21:20616742-20616764 ATATATTTATTCAGATCAAATGG + Intergenic
1177691497 21:24515328-24515350 TGCTATTTAATCAGAAAAAAAGG + Intergenic
1177691891 21:24521269-24521291 CTATATATATTAAGAAAATAGGG + Intergenic
1177774120 21:25549301-25549323 CTTTATTTTCTCTGAAAAATAGG - Intergenic
1177795240 21:25770135-25770157 CTTCATTTTATCAGAAACAAAGG - Exonic
1177977538 21:27870699-27870721 TTTTATTTATTCAGAAAGGTAGG + Intergenic
1178193729 21:30318473-30318495 TTTGATTTATTCAGAAACAAAGG - Intergenic
1178272202 21:31201217-31201239 CTTTTTTAAGTAAGAAAAAAGGG + Intronic
1178428331 21:32497397-32497419 ATTTAGTTATTCAGAAGACAAGG + Intronic
1178784562 21:35641212-35641234 CTTTTTTTTTTAACAAAAAAAGG + Intronic
1179016854 21:37601344-37601366 CTTGAATGATACAGAAAAAAAGG - Intergenic
1179332335 21:40415934-40415956 CTATTTTTAGGCAGAAAAAAAGG + Intronic
1179373096 21:40825117-40825139 ATTTATTTATTCAACAAATATGG + Intronic
1179993593 21:44961692-44961714 CTTAATTTAATCAGAAATGAAGG - Intronic
1181977425 22:26740829-26740851 TTTTATTTAATCTGAGAAAATGG + Intergenic
1182758111 22:32697475-32697497 ATTTATTCATTCAAAAAATATGG - Intronic
1182782321 22:32878013-32878035 CTTTATTTTTCAAGAAACAAAGG + Intronic
1182864319 22:33589673-33589695 CTTTCATTATTCAAAAACAAAGG - Intronic
1184078306 22:42198631-42198653 CTGTATATATTCAGAACAGATGG + Intronic
1184219802 22:43092570-43092592 CTTTATTAAATCAAAAAAAGAGG + Intergenic
1184339737 22:43879695-43879717 CTTTATTTATTTAGAGACAGGGG + Exonic
1184940896 22:47764081-47764103 CTTTTTTTTTTTAAAAAAAAGGG - Intergenic
1185038583 22:48492134-48492156 CTTTATCGGTTCTGAAAAAAGGG - Intronic
949326520 3:2871617-2871639 CTTTATTTTTTGAGAAACAAGGG + Intronic
949617162 3:5766392-5766414 TTTTATTTCTTCTAAAAAAATGG - Intergenic
949654010 3:6195636-6195658 CTTTAGGTATTATGAAAAAAGGG + Intergenic
949928960 3:9063503-9063525 CTCTATTTATGAAAAAAAAAAGG - Intronic
950356958 3:12419341-12419363 TTTGATTAATTCAGCAAAAAAGG + Intronic
951396248 3:22171103-22171125 ATTTATTTTTTCATAATAAATGG - Intronic
951897620 3:27625467-27625489 CTTTATTTGTTAAGACAAAAAGG - Intergenic
951998148 3:28754749-28754771 GTTAATTTATGAAGAAAAAAAGG + Intergenic
952150097 3:30579926-30579948 CTTTGTTTATTTACAAAATAAGG - Intergenic
952175254 3:30855366-30855388 ATTGATATTTTCAGAAAAAAAGG - Intronic
952283866 3:31948950-31948972 ATTTGATTATTCAGAGAAAAGGG + Intronic
952456360 3:33476216-33476238 CTTTGATTATTCAGAAGAACTGG - Intergenic
952599936 3:35068085-35068107 ATATACTCATTCAGAAAAAAAGG + Intergenic
952712479 3:36445328-36445350 CTTTCTTTATAAAGATAAAATGG - Intronic
953970433 3:47343176-47343198 TTGTATTTATTCTGTAAAAAAGG + Intronic
954343585 3:49976085-49976107 GTTTATTTATTTAAAAATAAAGG + Intronic
955197087 3:56814664-56814686 CTTAATTCATTTAAAAAAAAAGG - Intronic
955248216 3:57249346-57249368 CTTTCTTCATTCAGTAAAACAGG + Exonic
955615974 3:60806986-60807008 CTTTATTATTTCAGACAAATTGG - Intronic
955638309 3:61054361-61054383 CTTTTTTTTTCCAGAAAAAAAGG + Intronic
955765145 3:62336138-62336160 CTTTATTTTTTATGGAAAAAGGG - Exonic
956514712 3:70034019-70034041 CTATATTTAGGGAGAAAAAATGG + Intergenic
957345747 3:78959103-78959125 CTTGACTTATTAAGAAGAAAGGG - Intronic
957476425 3:80730515-80730537 CTTTACTTTTACAGAAAAAATGG + Intergenic
958046702 3:88293654-88293676 CTTTATTTCATCTAAAAAAAGGG + Intergenic
958086161 3:88810299-88810321 CTATGTTTGTCCAGAAAAAAGGG + Intergenic
958144384 3:89604945-89604967 CTTTGCATAGTCAGAAAAAAAGG - Intergenic
958145517 3:89618820-89618842 CTAAATTTAATCAGAATAAATGG + Intergenic
958455361 3:94324397-94324419 CCTTAATCATTCAGAAAGAAAGG + Intergenic
958486846 3:94723412-94723434 GTTTACTTTTTGAGAAAAAAAGG - Intergenic
958516895 3:95127662-95127684 CTTTATTTATCACTAAAAAATGG - Intergenic
958518542 3:95155203-95155225 CTTTATTTATTTATAAAATGGGG + Intergenic
958716211 3:97785302-97785324 ATTTATGTAATCAGAAAAAAGGG - Intronic
959220961 3:103519023-103519045 CTTTATAAATTAAAAAAAAAAGG + Intergenic
959227242 3:103601465-103601487 CTTTATTTACTAAGGAAAATGGG - Intergenic
959282778 3:104366744-104366766 TTTGATTTATTTAGAAAAAAAGG + Intergenic
959408589 3:105993293-105993315 GCTTCTTTAATCAGAAAAAAAGG - Intergenic
959780382 3:110225158-110225180 CTTCCTTTATTCTGAAAAAAAGG - Intergenic
959839035 3:110952478-110952500 GGTAATTTATACAGAAAAAAAGG + Intergenic
959856818 3:111169002-111169024 TTTTCTTTATTCACAAAGAAAGG + Intronic
960016963 3:112902335-112902357 ATTTATTTATTCAAAATAATGGG + Intergenic
960217272 3:115056873-115056895 CTTTATTTAACCAGAAAATATGG + Intronic
960358472 3:116681016-116681038 CTTTACTTATTCTCAAAGAAAGG - Intronic
960485495 3:118247488-118247510 CTTTTTTTAAGCAGAAAATATGG + Intergenic
960648557 3:119919427-119919449 TTTTATCTTTTCAGATAAAAGGG + Intronic
960872057 3:122260041-122260063 GTTTCGTTCTTCAGAAAAAATGG + Intronic
960910301 3:122643107-122643129 CTTAATTAACTCAGAAAACAGGG + Intergenic
961218323 3:125179198-125179220 TACTATTTATTCAGAAAAAGAGG - Intronic
961373785 3:126449231-126449253 CCTTATTTCTTAATAAAAAAAGG - Intronic
961588218 3:127953031-127953053 TTTTCTTTATTCATAAAATAAGG + Intronic
963095213 3:141530477-141530499 CCTTATTTATTTATAAAATATGG + Intronic
963193359 3:142498830-142498852 CTTTATTTCATTAGATAAAATGG + Intronic
963356910 3:144219877-144219899 CTTTATTTCTAAAGAAAACAAGG - Intergenic
963478801 3:145841174-145841196 GTTTGTTTTTTCATAAAAAATGG + Intergenic
963826642 3:149962503-149962525 CTTTAATTTTTTATAAAAAAGGG - Intronic
964683879 3:159373046-159373068 TTTTAATTTTTCTGAAAAAAGGG + Intronic
964968112 3:162524002-162524024 CTTTAATCATTGAGAAAAAGAGG - Intergenic
965244874 3:166254803-166254825 TTTTATTTCTTCTAAAAAAAAGG - Intergenic
965248632 3:166310568-166310590 CTTTATTTCTTTAGAACTAATGG + Intergenic
965295821 3:166944337-166944359 CTTTTCTTATTTATAAAAAAAGG + Intergenic
966288523 3:178326578-178326600 ATTTATTTGTTTAAAAAAAAGGG - Intergenic
966315606 3:178642280-178642302 GTTTATTTATCCATAAGAAATGG + Intronic
966427312 3:179793098-179793120 CTTTATTTTCTCAGCAAAATAGG + Intergenic
966547201 3:181163127-181163149 CTATATTAACTAAGAAAAAAGGG - Intergenic
966558131 3:181286848-181286870 CTTTTTTTTTTCAGGAACAATGG - Intergenic
966675015 3:182576050-182576072 AAATATTTATTCAGAAAAATAGG - Intergenic
966772058 3:183512797-183512819 ATTTATTTATTTATAAAAATAGG - Intronic
966871522 3:184292947-184292969 GTTTATTTTTACAGAAAAGAGGG + Exonic
967175820 3:186863173-186863195 CTTTAGTTATTTAGAAAAAAAGG + Intergenic
967398470 3:189033214-189033236 CTCTATTACTACAGAAAAAAAGG + Intronic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
967883936 3:194320734-194320756 TTTTAATTATTAAGTAAAAACGG + Intergenic
968108267 3:196019551-196019573 CTATGTTTATTCTGAATAAAGGG - Intergenic
968242982 3:197109191-197109213 CTTTATTTTTTTAGAGATAAGGG - Intronic
968944595 4:3656961-3656983 CTTCATTTATTGCAAAAAAAAGG + Intergenic
969545290 4:7822539-7822561 ATGTTTTTATTCAAAAAAAACGG + Intronic
969932619 4:10645947-10645969 CATTATTTATTAAGGAAAAAGGG + Intronic
969938628 4:10707796-10707818 CTTTATTCATTCAGAGGATAGGG + Intergenic
969961623 4:10950223-10950245 CTGGATTTATTTAGAAAAACTGG + Intergenic
970553706 4:17210176-17210198 CTTCATTTTTTTAAAAAAAAGGG - Intergenic
970905833 4:21215260-21215282 CTTCATTAATTGAAAAAAAAAGG - Intronic
971460811 4:26894057-26894079 TTTTATATTTTCAGTAAAAATGG + Intronic
971612857 4:28747625-28747647 CTTTATTAGTTCAGAAAATTAGG + Intergenic
971736482 4:30459997-30460019 CTCTATTTTTTCAGTAAAATGGG + Intergenic
971771361 4:30901128-30901150 CTTTATTTACTCTGTGAAAATGG - Intronic
971916762 4:32880308-32880330 ATATTTTTATTCAGATAAAATGG + Intergenic
972386420 4:38570728-38570750 CATTAGTTATTCAGGAAATATGG + Intergenic
972393171 4:38632305-38632327 CTTTGTTTTTTAAGAAAAAAAGG + Intergenic
972749244 4:41972330-41972352 GATAATTTATACAGAAAAAAGGG - Intergenic
972818250 4:42668894-42668916 CTTTGTTTATACAAAAAAAAGGG + Intergenic
972881065 4:43423007-43423029 CTTAGTATATTCTGAAAAAATGG - Intergenic
973029301 4:45315433-45315455 CTCTTTTTATTTAGAAGAAAGGG + Intergenic
973570485 4:52233984-52234006 TTTTATTTGTTCAAAAAAGAAGG + Intergenic
973796348 4:54431190-54431212 CCTTTTTCATACAGAAAAAAGGG - Intergenic
974017390 4:56660398-56660420 CTTTATATATTTAAAAAAACTGG + Intronic
974083565 4:57236652-57236674 CTTTTTTTATTCCGTAAAGATGG - Intergenic
974365386 4:60941421-60941443 CTTTATTTTTTCAAAAAACTTGG + Intergenic
974515809 4:62908466-62908488 CTTTATTTCTTCTAAAAAAATGG + Intergenic
974531182 4:63109542-63109564 GGTAATTTATACAGAAAAAAGGG - Intergenic
974693302 4:65330672-65330694 ATTTAATTTTTCAGTAAAAATGG - Intronic
974749768 4:66122604-66122626 CTTTATTTATTTAGATAATAGGG - Intergenic
974981452 4:68962358-68962380 TTTTTTTTCTTCAGTAAAAATGG + Intergenic
975131689 4:70838695-70838717 CTTTATTTTTTTAGAAAAGTCGG - Intronic
976122000 4:81793645-81793667 ATTTATATCTTGAGAAAAAACGG - Intronic
976238323 4:82925125-82925147 GTTTAGTGCTTCAGAAAAAAAGG + Exonic
976476820 4:85494158-85494180 CTTTATTTCTTCTAAAAAAATGG + Intronic
976518625 4:86001144-86001166 CTTCATTTCCTCAGCAAAAAAGG - Exonic
976766176 4:88600328-88600350 CTGTATTTCCTCAGAAACAATGG - Intronic
976920172 4:90431137-90431159 CTTTATTTAGACAGATATAATGG + Intronic
976989708 4:91350172-91350194 TTTTATTTAATCATTAAAAATGG + Intronic
977176291 4:93824384-93824406 CTCAAAGTATTCAGAAAAAATGG - Intergenic
977267156 4:94868490-94868512 ACTTTTTTATTCAGCAAAAAAGG + Intronic
977420465 4:96793512-96793534 CTTTATTTCTTCTAAAAAAATGG + Intergenic
977621375 4:99141514-99141536 TTTATTTTATTCAGAAAAAATGG - Intronic
978029118 4:103916596-103916618 CTTTATTTAGTGACAAAATATGG - Intergenic
978472188 4:109081282-109081304 GATCATCTATTCAGAAAAAAGGG + Intronic
978546662 4:109878336-109878358 CTTTTTTTTTTCTCAAAAAAAGG - Intergenic
978891054 4:113828090-113828112 CTTTAATTATTTACAGAAAATGG - Intergenic
978905670 4:114002605-114002627 CTTTATTTCTTATGGAAAAATGG + Intergenic
978912876 4:114085369-114085391 CTTTATTTTTTCAGAAATAATGG + Intergenic
978976805 4:114886716-114886738 CTTTATTCAATAAGAAAATAAGG + Intronic
979210957 4:118102076-118102098 GTTTATTTATTGAGAAAAAATGG + Intronic
979222540 4:118245833-118245855 TTTTTTTTAATCTGAAAAAATGG - Intronic
979246748 4:118515421-118515443 CTTTTTTTTTTTTGAAAAAAAGG + Intergenic
979415069 4:120427295-120427317 ACTAATTTATACAGAAAAAAGGG + Intergenic
979481590 4:121224978-121225000 CTATATTTATTCACATCAAAAGG + Intronic
979806879 4:124984716-124984738 CTTTGTTTATTTAAAAAAATCGG - Intergenic
980293810 4:130882612-130882634 CTTTATTTATACAAAAGAAGAGG - Intergenic
980364498 4:131782779-131782801 CTTTATTTTTTCAAATAAGATGG + Intergenic
980380578 4:132010081-132010103 CTTTATTTACTTATAAATAATGG - Intergenic
980435086 4:132761311-132761333 CTTTATTTACTCTGCAAAAGTGG + Intergenic
980678447 4:136122867-136122889 TTTTAATTATTCAGAAGATATGG - Intergenic
980743541 4:136984452-136984474 CTTTATTTATTCATGATACAAGG - Intergenic
980814685 4:137929083-137929105 GGTTATTCATACAGAAAAAAAGG + Intergenic
980921116 4:139086903-139086925 GTTTATTTTTTCAGAGGAAAAGG + Intronic
981057434 4:140378554-140378576 ATTTATTTATTTAGAAATGAGGG - Intronic
981269242 4:142824685-142824707 ATTTCTTTATTCAGATACAAGGG + Intronic
981639990 4:146930678-146930700 CTTTCTGTATTAAGAAAACAGGG - Intronic
981993206 4:150949091-150949113 TTTTATTTATTTGGGAAAAATGG - Intronic
982285628 4:153731088-153731110 CTTCATATATTGAGAAAATATGG - Intronic
982402685 4:154985625-154985647 CTTTATTTCTTCTAAAAAAATGG + Intergenic
982470893 4:155788692-155788714 CTTTATTTCTTCTGGCAAAATGG - Intronic
982496618 4:156102638-156102660 CATTATTTAAAAAGAAAAAAAGG - Intergenic
982651518 4:158093367-158093389 CTTTTTTTCTTCTGAAAATATGG + Intergenic
982762552 4:159303500-159303522 CTTTTTTTATTCAAAAGAATTGG + Intronic
982763038 4:159310813-159310835 GTGTCTTTATTTAGAAAAAAAGG + Intronic
983241161 4:165234823-165234845 CTACTTTTATTGAGAAAAAAAGG - Intronic
983246203 4:165290536-165290558 CTTTATACACTAAGAAAAAAGGG - Intronic
983317373 4:166149402-166149424 TTTTATGTATTCACAAAATATGG + Intergenic
983472220 4:168171518-168171540 CTCTATTAATTCAAAAAAAATGG - Intronic
983677066 4:170308003-170308025 CTTTATTAATTCAGAAATATGGG + Intergenic
983774207 4:171585793-171585815 AATTATTTTCTCAGAAAAAAAGG - Intergenic
983965548 4:173805762-173805784 CTTTACATATGCAGAAGAAAAGG + Intergenic
984172886 4:176382003-176382025 ATTTATTTTTTCTTAAAAAAAGG + Intergenic
984182609 4:176503230-176503252 CTTTGTTTCTTCAAGAAAAATGG - Intergenic
984564461 4:181311132-181311154 CTTTATTTATTATGACAAATAGG + Intergenic
984921804 4:184771140-184771162 CTTTAATTATTCAAACAAAGTGG + Intronic
984988951 4:185359406-185359428 TTTGTTTTACTCAGAAAAAATGG + Intronic
985319150 4:188689452-188689474 CTTTCTTTTTTGAGAATAAATGG + Intergenic
986075106 5:4328178-4328200 TTTTATTTATTCATAAAAATCGG + Intergenic
986501602 5:8406741-8406763 CTTAATTAATAAAGAAAAAAAGG - Intergenic
986749986 5:10778495-10778517 CTGTATTTATTCAAAAGCAATGG + Intergenic
986816387 5:11416619-11416641 ATTTATTTATTCAATAAACATGG + Intronic
986840852 5:11695569-11695591 TTCTATTTCTTGAGAAAAAATGG + Intronic
986861612 5:11932642-11932664 CTTCAGTTATTCAGAATAACTGG + Intergenic
986956265 5:13153845-13153867 TTTTATTTCTTCCAAAAAAAAGG - Intergenic
986990149 5:13543040-13543062 GTTTATTTTTCCAGAAAAACAGG - Intergenic
987222609 5:15805698-15805720 AGTAATCTATTCAGAAAAAAAGG + Intronic
987394714 5:17412287-17412309 CTTACTTTATTGAGATAAAAAGG - Intergenic
987501359 5:18713844-18713866 CTATAGTTTTTCTGAAAAAAAGG + Intergenic
987666757 5:20952536-20952558 CTTTCTTAATGCAGAAAACAAGG - Intergenic
987806407 5:22774718-22774740 GTTAATTTATACAGAAAAAGAGG - Intronic
987915804 5:24212389-24212411 GTTTATTTTTTTAAAAAAAAAGG - Intergenic
987977942 5:25039440-25039462 TTTCATTCATTCAGAAAAATTGG + Intergenic
988349981 5:30090203-30090225 CATTATTTCTGCAGATAAAATGG - Intergenic
988524280 5:31973122-31973144 TTTTATTGATTCATAAAGAAAGG + Intronic
989035560 5:37167968-37167990 CGTTATATGTTCAGAAGAAAAGG + Intronic
989258064 5:39387718-39387740 CTTTATAAATTAAAAAAAAATGG - Intronic
989774038 5:45181403-45181425 ATTTATTTATTAACAAACAAGGG - Intergenic
990015026 5:51050171-51050193 TTTTATTTTTTAAGAAAAAGTGG - Intergenic
990074983 5:51832870-51832892 CTTTAATTATACACAGAAAAGGG - Intergenic
990108764 5:52296276-52296298 CTTTATTTAATAAGTAGAAAAGG - Intergenic
990555356 5:56929158-56929180 TTTTTTTTAATCAGAAAAACAGG - Intronic
990804816 5:59647691-59647713 CTTTAAGTATTCAGAAGAAAAGG + Intronic
990875066 5:60474990-60475012 ATTTATTTTTTCTTAAAAAAAGG - Intronic
990934577 5:61134227-61134249 CTTATTTTATAAAGAAAAAATGG + Intronic
991518570 5:67467780-67467802 CTTTAGTTAGGCAGAGAAAAGGG + Intergenic
991901133 5:71461803-71461825 GTTTATGTATACAGAAACAATGG + Exonic
991944977 5:71890996-71891018 CTGTATTTATTGAGAAGCAATGG + Intergenic
992187984 5:74262230-74262252 CTTTCTTGATTCAGAAAAACTGG - Intergenic
992398401 5:76388421-76388443 GTTTATTTATTCAGCATAAAAGG + Intergenic
992477724 5:77119835-77119857 CTTTATTTTTTGTGAAAACAGGG - Intergenic
992628169 5:78653298-78653320 CCTTATTTGTAGAGAAAAAATGG - Intronic
993124516 5:83816771-83816793 TTTTATTAATACAGAAAAAATGG + Intergenic
993288043 5:86026358-86026380 TTTTATTTTTTCTGAAAAGATGG + Intergenic
993452595 5:88091111-88091133 ATTTAATTATTCAGGAACAAGGG + Intergenic
993514102 5:88808105-88808127 CTTTATTCATTCCAAAAAGATGG - Intronic
993538578 5:89119489-89119511 CTATATTTTTACAGAAAACAAGG - Intergenic
993686198 5:90941238-90941260 CTCTATTTATTTAGAGCAAATGG - Intronic
993853448 5:93040485-93040507 CATGCTTTATTCAGAAAATACGG + Intergenic
994234086 5:97341399-97341421 ATTTTTTCAATCAGAAAAAAAGG + Intergenic
994319580 5:98377335-98377357 CATTATTTATTGGGAAAAATTGG - Intergenic
994433144 5:99694661-99694683 CGTTAATTATTAAGAAAAAAGGG + Intergenic
994866982 5:105286843-105286865 ATTTACTTATTCAAAAAAGAAGG + Intergenic
994896818 5:105716633-105716655 CTTTATGTAATCAAAATAAATGG - Intergenic
995806103 5:116053807-116053829 ATTTCTTTATTCAGAAAGAATGG + Intronic
995845010 5:116484203-116484225 CTTTATATATTAAGAAAAATAGG + Intronic
995860275 5:116633777-116633799 GTTTATTTATAAAGAAAAAAAGG - Intergenic
995879147 5:116824398-116824420 CTTTATTTATTAATCAAAGAGGG + Intergenic
996193749 5:120578278-120578300 CTTTATTTCTTCTAAAAAAATGG + Intronic
996642967 5:125779531-125779553 TTTTATTTACCCAGATAAAATGG + Intergenic
996692686 5:126357612-126357634 CTTTTTTTTTTCCAAAAAAAAGG - Intergenic
996878898 5:128270798-128270820 ATTTATTGATTCATAAACAAAGG - Intronic
997623653 5:135317383-135317405 CTGTGTTTCTTCAGAAAACAAGG + Intronic
997794115 5:136790917-136790939 TTTTGTATATGCAGAAAAAAGGG + Intergenic
998685514 5:144519737-144519759 CTTTGTTTATTCAGAAAACAAGG + Intergenic
999138115 5:149337092-149337114 CTTTATTAATTTAAAATAAAAGG + Intronic
999161033 5:149499286-149499308 CTTTATTCCTTAAAAAAAAAGGG + Intronic
999914327 5:156240686-156240708 CTTAATTTAATAAAAAAAAATGG + Intronic
1000148909 5:158480792-158480814 CATTATTCATACTGAAAAAATGG + Intergenic
1000408522 5:160914596-160914618 TTTAAAATATTCAGAAAAAAGGG - Intergenic
1000470429 5:161633411-161633433 ATCTACTTATTCAGAAAATAAGG - Intronic
1000828068 5:166070759-166070781 CTTTATTTATTAACTTAAAACGG - Intergenic
1000960950 5:167600322-167600344 CTTTCTCTATTAACAAAAAAAGG - Intronic
1001222366 5:169912230-169912252 ATTTATTTATTTAGAAAATGGGG + Intronic
1002141434 5:177142826-177142848 CTTTATTTGTTCAGAAAATGAGG - Intronic
1002233356 5:177784450-177784472 CTTTTTTTTTTTAAAAAAAAAGG + Intronic
1003227500 6:4219342-4219364 TTTTATGTATTCACAAAAATAGG - Intergenic
1003388804 6:5694385-5694407 CTTCTATTATTCAGGAAAAAAGG - Intronic
1003591280 6:7438976-7438998 GTTTCTTTATTGTGAAAAAAAGG + Intergenic
1003628158 6:7762677-7762699 TTTTATTTAATCAGAATATAAGG - Intronic
1003726146 6:8766805-8766827 CTCTCTTTATCCAGAAACAAAGG + Intergenic
1003905530 6:10695825-10695847 CTTTAATTATCCAGAAAATTTGG + Intronic
1004825345 6:19414299-19414321 CTTATTTTATTCATTAAAAAGGG - Intergenic
1004991871 6:21147202-21147224 TTTTATTTATCCAGAAACATTGG - Intronic
1005125463 6:22442015-22442037 CCTTAGCTATTAAGAAAAAAGGG + Intergenic
1005153315 6:22777085-22777107 CTTTATTTGTCCAATAAAAATGG - Intergenic
1005352885 6:24953700-24953722 CTTTGTGTCTTCAGAAATAAGGG - Intronic
1006202148 6:32303491-32303513 ATTAATTTTTTCAAAAAAAAAGG - Intronic
1007192285 6:40029778-40029800 ATTTTTTGATTCAGAAAATAGGG - Intergenic
1007437765 6:41828604-41828626 CTTTATATATTCTGAATACAAGG + Intronic
1008114542 6:47532733-47532755 CTAAATTTATACAGAACAAAAGG - Intronic
1008241478 6:49118152-49118174 CTCTGATTATTCATAAAAAAGGG - Intergenic
1008428371 6:51385759-51385781 CTTCAATTATTCAGCAAAATAGG - Intergenic
1008434513 6:51459424-51459446 CTTTATTTATAAAAAAAAGATGG - Intergenic
1008477599 6:51949209-51949231 CTAAATTTTTTAAGAAAAAATGG - Intronic
1008669502 6:53753034-53753056 CCTTGTTTAATCAGATAAAAGGG - Intergenic
1009371751 6:62913007-62913029 TATAATTTATTAAGAAAAAATGG - Intergenic
1009466313 6:63973893-63973915 CTTTATTTTTCTAGAATAAAAGG + Intronic
1009518332 6:64649027-64649049 CCTTATATATACAGAAAGAAAGG + Intronic
1009573362 6:65418817-65418839 CTTTATTTCTTCTAAAAAAATGG - Intronic
1009603914 6:65840674-65840696 CTTAATTTTTACAGAAAAAAGGG - Intergenic
1009659942 6:66598134-66598156 CTTTATTTCTTCTCAAAATACGG + Intergenic
1009893385 6:69716533-69716555 ATTTATTAAATGAGAAAAAAAGG + Intronic
1009954589 6:70437864-70437886 CTATATTTATTAATAAAACATGG + Intronic
1010306387 6:74327932-74327954 CTTTATTTATGCCCAAAGAAGGG + Intergenic
1010407924 6:75526623-75526645 TTTTATTTTTTCAGCAAAATTGG + Intergenic
1010443670 6:75927687-75927709 CTTAATTTCTTCAGGAAGAAGGG - Intronic
1010642499 6:78346227-78346249 CTTTATTAATGCTGAAAAAATGG - Intergenic
1010738632 6:79471743-79471765 CTTTATTTAGTCATAAATAAAGG - Intergenic
1010845346 6:80700698-80700720 GTTTATTTTTTCAGAAATCATGG - Intergenic
1011041739 6:83036993-83037015 CTTCCATTATTCAAAAAAAAAGG + Intronic
1011443811 6:87415972-87415994 TTTTTTTTTTTCAGATAAAAAGG - Intronic
1012335671 6:98053460-98053482 CTTTGTTTATTCAGAAAAGCAGG - Intergenic
1012702936 6:102485802-102485824 TTTTTTTTTTTCAGAAAACATGG + Intergenic
1012719043 6:102718019-102718041 CTATCTTCCTTCAGAAAAAAAGG + Intergenic
1012839942 6:104317413-104317435 GTTTATTCATTCATAAAACATGG - Intergenic
1012886032 6:104847087-104847109 CTTTATTTGTTTCTAAAAAACGG + Intronic
1012924903 6:105257904-105257926 CTTTATTTTTTTAAAAAAACTGG + Intergenic
1013211804 6:107993623-107993645 CATTAGATAATCAGAAAAAAAGG + Intergenic
1013323639 6:109021778-109021800 CTATGTTGAATCAGAAAAAAAGG + Intronic
1014008355 6:116447430-116447452 ATTTATTTATTAAATAAAAATGG + Intergenic
1014064966 6:117113770-117113792 ATTAATTTTTTTAGAAAAAACGG - Intergenic
1014332678 6:120089413-120089435 TTTTATTGATTCAGAATAAGAGG - Intergenic
1014602115 6:123426218-123426240 TTTTATTTTCTGAGAAAAAAAGG + Intronic
1014669355 6:124281226-124281248 CACTATTTATTCATAAAATAAGG + Intronic
1014785229 6:125611201-125611223 GTTTCTTTATTTAAAAAAAAAGG - Intergenic
1014802001 6:125788927-125788949 CTTAATTTATTTACAAAACATGG + Intronic
1015065762 6:129024694-129024716 ATTAATTTATTTAGAAAAATTGG - Intronic
1015116644 6:129656811-129656833 CTTTATTTGCTCAGAGGAAATGG - Intronic
1015453911 6:133403281-133403303 ATTTGTTTATACAGAAAAACAGG + Intronic
1015730949 6:136347810-136347832 CTTCATTTTTTCCGTAAAAAAGG - Intronic
1016262549 6:142189541-142189563 ATTTATTTATTCTGAGTAAAAGG + Intronic
1017194066 6:151681663-151681685 CATTATTTATTCAGGCAAAGAGG - Intronic
1017194806 6:151687808-151687830 CTTTATTTTTTTAAAAAAAGAGG - Intronic
1017336550 6:153267838-153267860 CATTATTTACTCAGCAAATATGG - Intergenic
1017366243 6:153643525-153643547 TATTATGTATTCAGAAAAAAAGG + Intergenic
1017659295 6:156658241-156658263 GTTTTTTAATTCAGATAAAAGGG + Intergenic
1017956985 6:159186946-159186968 ATTATTTTATTCAGACAAAAAGG - Intronic
1018510720 6:164521345-164521367 GATAATTTATACAGAAAAAACGG - Intergenic
1018613812 6:165666292-165666314 TTTTATATATTCATAAAGAAAGG - Intronic
1018917727 6:168147102-168147124 TTTTGCATATTCAGAAAAAATGG - Intergenic
1019978833 7:4606107-4606129 CTTTATATTTTCATTAAAAAGGG - Intergenic
1020151209 7:5683252-5683274 GTTTATTCATTAAAAAAAAAGGG + Intronic
1020338069 7:7079712-7079734 GTTTATTTATGCTGAAAAACAGG + Intergenic
1020420199 7:7995137-7995159 TTTTATTTAATAAGAAATAAAGG - Intronic
1020481221 7:8664045-8664067 CTTTCTAAATTCAGTAAAAAGGG - Intronic
1020523251 7:9222202-9222224 ATTTAGTTCTTCACAAAAAATGG + Intergenic
1020622662 7:10536483-10536505 TTTTCTTTATCCTGAAAAAAAGG - Intergenic
1020709790 7:11592858-11592880 TTTTATTTATATAAAAAAAAAGG - Intronic
1020736957 7:11962696-11962718 CTTTATGTATTCAAAATAAGGGG - Intergenic
1020907340 7:14079858-14079880 CATTATTAATTGAAAAAAAATGG + Intergenic
1021187608 7:17583470-17583492 TTTTATTTCTTCTAAAAAAAAGG - Intergenic
1021320334 7:19202136-19202158 CTTTATATATACCAAAAAAAGGG + Intergenic
1021334326 7:19380022-19380044 CTTTATCTAATCAGAATAAGAGG + Intergenic
1021588137 7:22232081-22232103 CTATATTTTTTTAGACAAAATGG + Intronic
1021886105 7:25141240-25141262 CTTTATTTCTTCAAAAGCAATGG + Intronic
1022085617 7:27064595-27064617 CTTTTTTTTTAAAGAAAAAATGG - Intergenic
1022147852 7:27564381-27564403 CTACATATATTAAGAAAAAAAGG - Intronic
1022590721 7:31659606-31659628 CTACATTTATTCAGATTAAATGG - Intergenic
1022673286 7:32475953-32475975 TTTTTTTTTTTAAGAAAAAATGG - Intergenic
1022953612 7:35361951-35361973 GTTTCTTTATCCAAAAAAAAAGG + Intergenic
1023115610 7:36859040-36859062 ATTTATTTATTGGGAAAAACAGG - Intronic
1023426109 7:40038194-40038216 CTTTTTTTATATATAAAAAAAGG - Intronic
1023426110 7:40038195-40038217 CTTTTTTTATATATAAAAAAAGG + Intronic
1023661205 7:42472828-42472850 CTTTATTTACAAAGAAAAACAGG + Intergenic
1024223527 7:47306035-47306057 TTTTAATTATACTGAAAAAAAGG + Intronic
1024304511 7:47916381-47916403 ATTTATTTATTTATAAAAAGTGG - Intronic
1024710375 7:52008857-52008879 CTTTTTCTATGCAGAAAAACAGG + Intergenic
1025709625 7:63895550-63895572 CTTCATTTTATCAGAAACAAAGG - Intergenic
1026220226 7:68389830-68389852 CTGTGTTTATTCATAAAACATGG + Intergenic
1026226954 7:68450648-68450670 ATTTATTTATAAAGAAAAAGAGG - Intergenic
1026698088 7:72613711-72613733 CTTTGTTTATAAAGAAAATATGG - Intronic
1027480322 7:78687627-78687649 CTTCAGTTATCCAGAAAAATTGG - Intronic
1027676430 7:81163893-81163915 CTTCGTTTATTTAGAATAAAAGG - Intergenic
1027810250 7:82887671-82887693 ATTTATTTACTCAGTAACAAAGG - Intronic
1027915094 7:84307765-84307787 TTTCCTTTATCCAGAAAAAAAGG - Intronic
1028010042 7:85630513-85630535 CTATTTTTATTCAGCCAAAATGG - Intergenic
1028017105 7:85729855-85729877 TTTTATTTATTAAGAAGAAATGG - Intergenic
1028167783 7:87558365-87558387 CTATCATTATTCAGAATAAATGG - Intronic
1028187844 7:87809710-87809732 ATTTATTTATTCAGAACAACTGG - Intronic
1028276173 7:88860233-88860255 TTTTATTTCTTCAAAGAAAAAGG - Intronic
1028653875 7:93180325-93180347 GCTTATTAATTCTGAAAAAATGG + Intergenic
1028662978 7:93303601-93303623 ATTTTTTTTTTCAAAAAAAAGGG - Intronic
1028691346 7:93656191-93656213 CTTTTATTATTCTGATAAAATGG + Intronic
1028910068 7:96197884-96197906 CTCTATTTCTTTTGAAAAAATGG + Intronic
1029268912 7:99364654-99364676 ATTTATTCATTGAGGAAAAATGG + Intronic
1029299845 7:99572112-99572134 GTTTATTTACTCTGAAAAACAGG - Intronic
1029510120 7:100989046-100989068 GGTAATTTATACAGAAAAAATGG - Intronic
1029835138 7:103301482-103301504 CTTTATTTACACAGAACAACAGG + Intronic
1029865690 7:103625678-103625700 CTTTATTTCTTCTAAAAAAAGGG - Intronic
1030425608 7:109373546-109373568 CTTTATTTACATGGAAAAAATGG + Intergenic
1030467222 7:109918457-109918479 CTTTATTTAGTCATTGAAAATGG + Intergenic
1030825866 7:114157003-114157025 ATTTATTTATTTGGAAATAATGG + Intronic
1030861755 7:114640305-114640327 CTTTTTTTATGGAAAAAAAATGG + Intronic
1030863025 7:114660189-114660211 GTTTATTTACTTAGACAAAAGGG + Intronic
1030964542 7:115974012-115974034 ATTTATTGGTGCAGAAAAAAAGG - Intronic
1031615138 7:123871046-123871068 CTTTCTTTCCTCAGGAAAAAAGG + Intronic
1031688099 7:124757210-124757232 TTTGATTTTTTCAGAAGAAAAGG + Intronic
1031737060 7:125378984-125379006 CTTTTTTTATTTTGCAAAAAAGG + Intergenic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1032556920 7:132845935-132845957 CTTTATTAATACTGAATAAAAGG - Intronic
1032612810 7:133434022-133434044 GTTTATTTCTTAAGATAAAATGG - Intronic
1032751221 7:134843669-134843691 AATAATTTATTCAGAATAAATGG + Intronic
1033384050 7:140853981-140854003 CTTTATTTATTTTTAAAACAGGG + Intronic
1033449963 7:141453910-141453932 CTTTTTTTTTTTAGATAAAAGGG - Intronic
1033819281 7:145114274-145114296 CCTTATTCATTTGGAAAAAATGG + Intergenic
1033871124 7:145753514-145753536 CTTGATTGTTTCAGACAAAAGGG + Intergenic
1034098660 7:148432724-148432746 CTTTATTTTTTCTGCAAAATGGG + Intergenic
1034589961 7:152130679-152130701 CCATATTTATAAAGAAAAAACGG - Intergenic
1034860254 7:154588658-154588680 ATTTATTTATTTCTAAAAAAAGG + Intronic
1035787764 8:2275846-2275868 CCATATATATTCAGAAATAAGGG + Intergenic
1035805047 8:2445870-2445892 CCATATATATTCAGAAATAAGGG - Intergenic
1036067610 8:5400226-5400248 CTTTCTTTAATGAGAAAACATGG - Intergenic
1036781742 8:11652549-11652571 CTTTATCTATTCACACATAATGG + Intergenic
1037079319 8:14764069-14764091 TTTTATTTTGTCAGGAAAAAAGG + Intronic
1037190144 8:16114647-16114669 TTTTGTCTAGTCAGAAAAAAAGG + Intronic
1037225927 8:16589849-16589871 CTTAGTTTAATCAGAAAGAAAGG - Intergenic
1037690116 8:21174429-21174451 TTTTATTTATTCTAAAGAAATGG - Intergenic
1037919554 8:22795850-22795872 ATTTTTTGATTCAGAAAATAAGG - Intronic
1037947716 8:22999639-22999661 CTTTTTTCATTCACAAAAAAAGG - Intronic
1037988483 8:23304309-23304331 CCTTGTTTATTCTGAAACAAGGG - Intronic
1038026990 8:23599942-23599964 GTTTATTCATTCAGCAACAAAGG + Intergenic
1038360240 8:26868105-26868127 CTTTATTGATGCAGACAAAGTGG + Intergenic
1038551031 8:28468991-28469013 TTTTTTTTAATTAGAAAAAAAGG - Intronic
1038572934 8:28678657-28678679 ATTAATTTATAAAGAAAAAAAGG - Intronic
1038759846 8:30376243-30376265 ATTTATTTATTCATAGAAATGGG + Intergenic
1039030524 8:33304187-33304209 CTTTATTTCTTCTAAAAAAATGG - Intergenic
1039868198 8:41524030-41524052 CTTCATGCATTCAGAAAAACCGG + Intergenic
1040032543 8:42839412-42839434 CTTTATTTATTTAAAAAATCAGG - Intronic
1040053212 8:43035505-43035527 CTTTATTTGTTCATAAGACAGGG + Intronic
1040454116 8:47578767-47578789 TTGTATTTATTCTGATAAAAAGG + Intronic
1040475617 8:47774765-47774787 CTTTTTTTAATTAAAAAAAAAGG - Intronic
1040573476 8:48629737-48629759 CTTTATATGTACAGAAAAACTGG + Intergenic
1040642441 8:49353000-49353022 CTTTATTTATTTTTTAAAAAAGG - Intergenic
1040767918 8:50938146-50938168 GTTTATTTTTTCAGCAATAATGG - Intergenic
1040801162 8:51342448-51342470 CTTAAATTAATCAGGAAAAATGG + Intronic
1040843010 8:51804510-51804532 CTGTATTTATGGAGTAAAAAGGG - Intronic
1041204964 8:55489587-55489609 CTTTTGTTATTTAAAAAAAAAGG + Intronic
1041350589 8:56944345-56944367 CTTTATGTTGTCACAAAAAAGGG - Intergenic
1042151165 8:65786103-65786125 CTTAATTTCTTAAGCAAAAAAGG + Intronic
1042387829 8:68198252-68198274 TTTTATTTGTTCATCAAAAAAGG - Intronic
1042413763 8:68495359-68495381 CTATGTTTATTAAGATAAAATGG - Intronic
1042530738 8:69812128-69812150 CTTAAATTATCCAGAATAAATGG + Intronic
1042682879 8:71406273-71406295 ATTTATGAATTCACAAAAAATGG + Intronic
1042740987 8:72046223-72046245 CTTTCTTTATTAACAAATAAAGG + Intronic
1042761898 8:72280384-72280406 CTTTTTTTTATCAGCAAAAACGG + Intergenic
1042792330 8:72622192-72622214 CTTTTTTTGTTCTGAAAAATAGG + Intronic
1042925811 8:73967422-73967444 CTTTATTTATGGGCAAAAAAGGG + Intronic
1042983185 8:74553403-74553425 TTTCAATTACTCAGAAAAAATGG + Intergenic
1043136796 8:76537541-76537563 CTTTTTTTTTTTAAAAAAAAAGG + Intergenic
1043632622 8:82355491-82355513 CTTTATTTTCTCAGTATAAAAGG + Intergenic
1044017517 8:87062365-87062387 CTTACATTATTAAGAAAAAATGG + Intronic
1044071344 8:87763932-87763954 CTAGTTTTATACAGAAAAAAAGG - Intergenic
1044098001 8:88093060-88093082 GTTTATTGTTTAAGAAAAAAAGG + Intronic
1045042514 8:98239724-98239746 TTTTATTTATCTAGTAAAAAAGG + Intronic
1045153718 8:99440901-99440923 CTTTATTAATTCAGGTTAAAAGG - Intronic
1045885228 8:107088282-107088304 CTTTATTCATTCAACAAAGATGG - Intergenic
1045900427 8:107272871-107272893 TTTTATGTATTCTTAAAAAAGGG - Intronic
1046074045 8:109295668-109295690 CTTTATTTACCCAGAACTAAAGG + Intronic
1046087762 8:109460222-109460244 TTATATTTACTCAGAAAATATGG + Intronic
1046233911 8:111395958-111395980 ATTTATTTATTTTAAAAAAATGG - Intergenic
1046406090 8:113774523-113774545 CTGTATTTCTTCGGAAAATATGG + Intergenic
1046599758 8:116302353-116302375 ATTTATTTATTTAAACAAAAAGG + Intergenic
1046631787 8:116629024-116629046 GCGTATTTTTTCAGAAAAAAAGG - Intergenic
1046767782 8:118089090-118089112 TTATTTTTATACAGAAAAAAAGG + Intronic
1046877796 8:119275763-119275785 TTTTATTAATTCAGAAAATATGG - Intergenic
1047028382 8:120849523-120849545 CTTTATTGGTTAAAAAAAAAAGG + Intergenic
1047172812 8:122510577-122510599 CTTTATTAGTTCAAAAAAATTGG + Intergenic
1047319593 8:123767428-123767450 CTTTATTTCATCAGACATAATGG + Intergenic
1047404032 8:124569991-124570013 CTTTCTTTCTTCAGACCAAATGG - Intronic
1047746318 8:127847732-127847754 CTTTTTTTTTACAGAAAAGATGG - Intergenic
1048875575 8:138834629-138834651 CTTTATTTCATCTGTAAAAAGGG + Intronic
1049561571 8:143314423-143314445 ATTTATTTATTTAGTAGAAACGG - Intronic
1049949031 9:626587-626609 ATTTATTTATTCACTAAATAAGG - Intronic
1050406973 9:5319836-5319858 CTTTATGAAGTCAGAAAATATGG + Intergenic
1050420093 9:5454413-5454435 CTTTTTTTTTTCAGCAAAAGTGG + Intronic
1050690253 9:8219584-8219606 CTAAAGTTATTCTGAAAAAAAGG + Intergenic
1050993841 9:12188220-12188242 TTTTTTTTCTTTAGAAAAAATGG - Intergenic
1051138686 9:13953639-13953661 TTCTATTTATCCAGAAAAAGAGG + Intergenic
1051304455 9:15693731-15693753 GTTTATAGATACAGAAAAAATGG - Intronic
1051534990 9:18147328-18147350 TTTTAGTTAATCAGGAAAAAAGG + Intergenic
1051820152 9:21155555-21155577 CTTAATTTAGTCAGAAAGAAAGG + Intergenic
1051916428 9:22213915-22213937 ATTTATATATCTAGAAAAAAAGG - Intergenic
1051942543 9:22525947-22525969 CTTTATGAACTCAGAATAAAAGG + Intergenic
1052051496 9:23853440-23853462 CTTTATTTAGTCAGGGAAAATGG + Intergenic
1052430375 9:28358851-28358873 TTTTATTCATTCAAAAAAATAGG + Intronic
1052774225 9:32717711-32717733 CTTCTACTATTCAGAAAAAAGGG + Intergenic
1053270317 9:36745141-36745163 CTTTATTTATTCAGCAAATTTGG + Intergenic
1053628847 9:39908670-39908692 CTTTATTTTTTCAAATAAGATGG + Intergenic
1053777219 9:41557675-41557697 CTTTATTTTTTCAAATAAGATGG - Intergenic
1053927810 9:43083611-43083633 GGTAATTTATTAAGAAAAAAAGG - Intergenic
1054215040 9:62342032-62342054 CTTTATTTTTTCAAATAAGATGG - Intergenic
1054364512 9:64320811-64320833 CTTTATTTTTTCAAATAAGATGG + Intergenic
1054672441 9:67813317-67813339 CTTTATTTTTTCAAATAAGATGG + Intergenic
1054949972 9:70838836-70838858 ATCTATTAATTGAGAAAAAAAGG + Intronic
1055378145 9:75673402-75673424 ATTTATTTATTTAGAGACAAGGG + Intergenic
1056009622 9:82313543-82313565 CTTTCTTTATGAAGAGAAAAAGG - Intergenic
1056243876 9:84674898-84674920 CATTATTTATACAGGAAAATGGG + Intronic
1056306165 9:85292633-85292655 CTTTATTTATTTGGAAATATTGG - Intergenic
1056328059 9:85497737-85497759 CTAAACTAATTCAGAAAAAAAGG + Intergenic
1056418153 9:86397762-86397784 TTTTAATTATAAAGAAAAAAAGG - Intergenic
1056674453 9:88662574-88662596 CTTTGTTCATTCAGAAAAACAGG + Intergenic
1056689585 9:88795762-88795784 CTTTACTTATTAAAAAAATAAGG + Intergenic
1056993100 9:91428840-91428862 TTTTATTCATTCAGATTAAATGG + Intergenic
1057229867 9:93314685-93314707 CATTATTAATTGACAAAAAATGG + Intronic
1058109204 9:101012984-101013006 ATGTATTTATGCAGAAAGAAGGG - Intergenic
1058119361 9:101121459-101121481 CTTTATTTCTTCATAAAAGGTGG - Intronic
1058137007 9:101318158-101318180 ATTTATTTATTTAGTAAAGATGG - Intronic
1058161577 9:101575692-101575714 TTTTATTTGTTCAGTAAATATGG + Intronic
1058186260 9:101859293-101859315 CCATTATTATTCAGAAAAAAAGG + Intergenic
1059127413 9:111704333-111704355 CTTTTTTTATTCCTTAAAAATGG + Intronic
1059576716 9:115497276-115497298 CTTTATTTTTTCACATATAAAGG + Intergenic
1059745631 9:117198058-117198080 CTTTATTTCTTCTAAACAAAAGG + Intronic
1059837589 9:118173338-118173360 CATTATTTATAAAGTAAAAATGG + Intergenic
1060100088 9:120832697-120832719 CTGTGTTTATTCAGCAAAAAAGG - Intronic
1060384508 9:123212045-123212067 CTTTTCTTATTCAGAGCAAAAGG - Intronic
1060443619 9:123666950-123666972 CTTTATTTATTCAAACAAATAGG + Intronic
1060709459 9:125843557-125843579 CTTTATTTATTAATAAAAGACGG + Intronic
1060987343 9:127827341-127827363 TTTTATTTAATAAGAAACAAAGG + Intronic
1061771689 9:132928988-132929010 CTTTTTTTATGGAGAAAAATGGG - Intronic
1185819896 X:3192434-3192456 TTTTATTCATTCAAAAAAAATGG + Intergenic
1186299966 X:8189865-8189887 CTTTATTTATTTAGAAGTCAGGG - Intergenic
1186366140 X:8895609-8895631 CTTTATTTCTTCTAAAAAATGGG - Intergenic
1186624062 X:11273125-11273147 CTTTATTTACCAAAAAAAAAGGG - Intronic
1187161008 X:16765297-16765319 CTTTATTTATTCAGAAAAAAAGG - Exonic
1187209303 X:17213342-17213364 CTTTATTTATTCTAAAAATGAGG - Intergenic
1187305489 X:18091685-18091707 CTTTATGGTTTCAGAAGAAAGGG + Intergenic
1187547993 X:20270949-20270971 ATTTATTTTTTCACAAAAAAAGG + Intergenic
1187747815 X:22428903-22428925 TTTTAGTTATTCAGGCAAAATGG - Intergenic
1187844868 X:23524785-23524807 CTCTATTTAGGCAGAAGAAATGG - Intergenic
1187972077 X:24668832-24668854 TTTTATTTATTCATTAAAACAGG - Intronic
1188175970 X:26989748-26989770 TTTTTTTTTTTCAGAGAAAAAGG + Intergenic
1188185682 X:27111637-27111659 TTTTACTCATGCAGAAAAAAAGG + Intergenic
1188632855 X:32389755-32389777 CTGTATATCTTCAGAAATAAAGG - Intronic
1188676771 X:32951183-32951205 CTGTATTCCATCAGAAAAAATGG - Intronic
1188972200 X:36632140-36632162 CTTAATTTATTCCAAACAAATGG + Intergenic
1189250083 X:39594106-39594128 CTTTGTTAAGTCAAAAAAAAAGG + Intergenic
1189439357 X:41020505-41020527 ATTTATTCATTGAAAAAAAATGG + Intergenic
1191803453 X:65106617-65106639 CTTGATTTAATAAGAAGAAAGGG + Intergenic
1191834274 X:65447227-65447249 CATTATCTAGTCAGATAAAAAGG - Intronic
1191935732 X:66425365-66425387 ATTTATTTTTTCAGGAAAACAGG - Intergenic
1191945413 X:66529292-66529314 CTTAATGTATACAGTAAAAAAGG - Intergenic
1192099542 X:68249586-68249608 CTTTATTTGATCAGAGAAGAAGG - Intronic
1193495330 X:82204221-82204243 ATTTATTTCTTCTAAAAAAATGG + Intergenic
1193629803 X:83869762-83869784 CTTTGTTTTTTTAGAAATAAAGG + Intronic
1194061720 X:89211142-89211164 CTTTATTTATTGCAAAAATATGG + Intergenic
1194270906 X:91813810-91813832 CTATTTTTATTCAGAAGAAAAGG - Intronic
1194527640 X:94997575-94997597 CTTTATATATACTGAGAAAATGG + Intergenic
1194793525 X:98181199-98181221 CTGTATTTATGCAAAAAGAAAGG - Intergenic
1194951411 X:100131050-100131072 CTTTATTTAGACACGAAAAATGG + Intergenic
1195298779 X:103506918-103506940 TTTTATTTCTTCTAAAAAAATGG + Intronic
1195438908 X:104878837-104878859 ATTTGTTCATTCAAAAAAAAAGG - Intronic
1195644759 X:107217023-107217045 TTTTATTTGTTCATTAAAAATGG + Intronic
1195901079 X:109797916-109797938 ATTTATTTAATTGGAAAAAAAGG - Intergenic
1195937021 X:110135227-110135249 CTTTTTTTTTTTAGAAGAAAAGG - Intronic
1196500390 X:116374219-116374241 CTTTATTTTTTAAAAAAGAATGG + Intergenic
1196568256 X:117233841-117233863 CTTCTTCTATTTAGAAAAAAAGG - Intergenic
1197103030 X:122678983-122679005 TTGTATTTATTCAGACAATAGGG - Intergenic
1197486639 X:127059604-127059626 TTTTAGTCATCCAGAAAAAATGG + Intergenic
1197996274 X:132378290-132378312 CTTGATTTATTCAAAAGAACTGG - Exonic
1198462776 X:136879549-136879571 CTTTAGTTATTAAGGAACAATGG - Intronic
1198640450 X:138750221-138750243 CTTTATTTATTTAAAAAAATGGG - Intronic
1198777322 X:140193802-140193824 CTTTTTTAATTTAAAAAAAACGG - Intergenic
1199001628 X:142645222-142645244 TTAAATTTATTCAGAAAAAAAGG - Intergenic
1199064296 X:143396233-143396255 CTTTTAATGTTCAGAAAAAAAGG - Intergenic
1199125355 X:144112537-144112559 CTTCATTTCTTCTAAAAAAATGG + Intergenic
1199127478 X:144139732-144139754 GGTAATTTATACAGAAAAAAAGG + Intergenic
1199253972 X:145697759-145697781 GTTTGTTGATTGAGAAAAAAAGG + Intergenic
1199749015 X:150797220-150797242 GTTTATTTATACAGTAAAAAGGG + Intronic
1199752198 X:150830626-150830648 CTTCCTTAACTCAGAAAAAAAGG - Intronic
1200346119 X:155451146-155451168 CGTAATTTATACAGAAAAATAGG - Intergenic
1200550103 Y:4569000-4569022 CTTTTTTTCTGTAGAAAAAAAGG + Intergenic
1200588147 Y:5035246-5035268 CTATTTTTATTCAGAAGAAAAGG - Intronic
1200715643 Y:6540446-6540468 CTTTATTTATTGCAAAAATATGG + Intergenic
1200906365 Y:8486696-8486718 CTTTATTTAACAACAAAAAAAGG - Intergenic
1200943922 Y:8812921-8812943 CTTTCTCTATTCAGAAACAATGG - Intergenic
1201209425 Y:11665923-11665945 TGTTATTTATTCAAAAAGAATGG + Intergenic
1201609587 Y:15825857-15825879 CTTTATTTATAAGGAAAAATTGG - Intergenic
1201853802 Y:18518768-18518790 ATTTATTTATTTTGGAAAAAAGG + Intergenic
1201879519 Y:18801616-18801638 ATTTATTTATTTTGGAAAAAAGG - Intronic