ID: 1187165985

View in Genome Browser
Species Human (GRCh38)
Location X:16804308-16804330
Sequence TTATTTAACCAGTTCCCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 4, 2: 29, 3: 96, 4: 380}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187165983_1187165985 -6 Left 1187165983 X:16804291-16804313 CCTTGTATGGTTGGCCGTTATTT 0: 1
1: 0
2: 0
3: 9
4: 74
Right 1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG 0: 1
1: 4
2: 29
3: 96
4: 380
1187165980_1187165985 18 Left 1187165980 X:16804267-16804289 CCTTTGAATGGCTGCATGGTTTT 0: 1
1: 1
2: 13
3: 218
4: 3514
Right 1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG 0: 1
1: 4
2: 29
3: 96
4: 380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187165985 Original CRISPR TTATTTAACCAGTTCCCTAT TGG Intronic
901606132 1:10460839-10460861 TTTTTTAACATGTTCCATATGGG + Exonic
904583777 1:31567470-31567492 TCAAATTACCAGTTCCCTATTGG - Intergenic
904643679 1:31949526-31949548 TTATTTAACAGGTTCCCTATTGG + Intergenic
906751169 1:48262548-48262570 TAATTTAACCATTCCTCTATTGG - Intergenic
907617647 1:55940712-55940734 TAATTTAACCACCTCCCTAATGG + Intergenic
907734210 1:57095848-57095870 TTATTTAACAAATTACATATAGG - Intronic
908551279 1:65211060-65211082 TAATTTAACCAATCCCCTAATGG - Intronic
909304528 1:74056567-74056589 TTATTCAGACAGTTCACTATTGG - Intronic
909493566 1:76252518-76252540 ATATTTTACCAGTTCCCTTGAGG + Intronic
909535208 1:76728221-76728243 TGTTTTAACGAGTTCCCTGTAGG + Intergenic
910054903 1:83021945-83021967 TTATGAAACCAGTTTTCTATGGG + Intergenic
910350042 1:86286195-86286217 GTATTTAACCAGTCCCTTATTGG - Intergenic
910362813 1:86431388-86431410 TTATTCAACCAGTCTCCTCTTGG + Intronic
911750348 1:101489252-101489274 TTATTTATCCAGTTCACCACTGG + Intergenic
912326385 1:108767300-108767322 TTCTTCAGCCAGTTTCCTATTGG + Intronic
912339120 1:108893434-108893456 TTTTTTACCCAGTACTCTATTGG + Intronic
912589716 1:110804265-110804287 TTCTTTATCCAGTCCACTATTGG + Intergenic
913175498 1:116269261-116269283 TTCTTCAACCAGTCCCCTGTGGG + Intergenic
913288275 1:117247923-117247945 ATGTTTAACCAATCCCCTATTGG - Intergenic
913471966 1:119197025-119197047 TGATTTAACCATCTCCTTATGGG + Intergenic
914046198 1:144094953-144094975 TTATTTAACCAGTCTCCTTTAGG - Intergenic
914131912 1:144865732-144865754 TTATTTAACCAGTCTCCTTTAGG + Intergenic
914383723 1:147146702-147146724 TTCTTTTACCTGTTTCCTATTGG + Intergenic
915023831 1:152807128-152807150 CTCTTTAACCAGTTACCTAATGG - Intronic
916876596 1:168976495-168976517 TTAAATAACCCCTTCCCTATAGG + Intergenic
918222906 1:182452279-182452301 TTATTTAATCTATTCCATATGGG - Intronic
918958888 1:191245085-191245107 TTCTTTATCCAGTTCACCATTGG + Intergenic
920331788 1:205213686-205213708 TTATTTAACAAGTCTTCTATTGG + Intergenic
920864234 1:209738261-209738283 TAATTTAAACATTTCCCTATAGG - Intergenic
921636508 1:217501327-217501349 TTGTTTAACCATTCACCTATCGG + Intronic
923757411 1:236805024-236805046 TTATTTAGCTGTTTCCCTATGGG + Intronic
924210405 1:241760249-241760271 TTATTCAACTAGTCCCCTGTAGG + Intronic
1064189227 10:13190893-13190915 TCATTTAAACAATTCCCTGTGGG + Intronic
1064245411 10:13664066-13664088 TTATTTTACCATCTCCCTTTTGG - Intronic
1068075301 10:52246574-52246596 TTATTTAAAGAGTCCCCTATAGG + Intronic
1068527544 10:58147643-58147665 TTATTTCACTAGTTACCCATTGG - Intergenic
1069271936 10:66539636-66539658 TTCTTTAGCCAGATCCCCATGGG - Intronic
1069428120 10:68308252-68308274 TTGTTTAACCATATCCCTTTGGG + Intronic
1069910560 10:71756392-71756414 TTATTGAAGCAGTCCCCTGTTGG + Intronic
1070032354 10:72689557-72689579 GTATTTAACCATTTCCCTATTGG + Intergenic
1070066059 10:73035577-73035599 TTATTTAACCAGTACTTAATTGG - Intronic
1070117809 10:73545672-73545694 TTGTCTAACCTCTTCCCTATAGG - Exonic
1070208942 10:74294810-74294832 TTTTTTACCCAGTTTTCTATTGG + Intronic
1071574848 10:86717723-86717745 ATGTTTACCCAGTCCCCTATTGG + Intronic
1071979566 10:90989842-90989864 TTACTTATCCATTTCCCTATTGG + Intergenic
1072160149 10:92758701-92758723 TTATTTACTCAGTTTCTTATTGG + Intergenic
1072476966 10:95771221-95771243 CTATTTAACCATTTCCTTTTGGG + Intronic
1072750870 10:97977765-97977787 TAACTCAACAAGTTCCCTATTGG + Intronic
1072792885 10:98331467-98331489 TTATTTAACTACATCCCTAATGG - Intergenic
1072956722 10:99893377-99893399 ATATTTAACTAGTCCCCTGTTGG - Intronic
1073804341 10:107080331-107080353 TCATTTTACTAGTTGCCTATAGG - Intronic
1074230232 10:111526498-111526520 TGTTTTAACCATTTCCCTCTTGG + Intergenic
1075285315 10:121180291-121180313 TTATTTAACCTGTTCCTTACTGG + Intergenic
1076411753 10:130256595-130256617 TTGTTTAACAAGTCCCCTAGTGG + Intergenic
1077964450 11:7113730-7113752 TAATTTAACTATTTACCTATTGG - Intergenic
1079058996 11:17231299-17231321 TTGTTTATCCATTTACCTATTGG + Intronic
1079498973 11:21080566-21080588 TTATTTAAACAGATCACTATTGG + Intronic
1080874074 11:36260789-36260811 TTATTTAGCCAGTTTCCTATTGG - Intergenic
1080889278 11:36395200-36395222 TTATTTAACCAGTCCCCTATGGG - Intronic
1080919012 11:36690013-36690035 TATTTTAACAAGTTCCCTAGAGG - Intergenic
1081940853 11:46940252-46940274 TTATTTAACCAGTCCCGCACTGG + Intronic
1084137393 11:67195874-67195896 TTTTATAACCAGTTCTCAATAGG + Intronic
1085021204 11:73210069-73210091 GTATTTAACCAGTCCTCTGTTGG - Intergenic
1086394694 11:86402492-86402514 TTGTTTAACCAATCTCCTATTGG + Intronic
1087141923 11:94772605-94772627 TTGTTTAACCATTCACCTATGGG + Intronic
1087286955 11:96275082-96275104 ATATTTAATAAATTCCCTATGGG + Intronic
1087897087 11:103598363-103598385 TTATTCAACTAGTCCTCTATCGG + Intergenic
1088184047 11:107143714-107143736 GTATTTAATCAGTGCCCTATTGG - Intergenic
1088550485 11:111007837-111007859 GTATTTAACCAATTCCTTATTGG - Intergenic
1089431956 11:118432507-118432529 TACTTTAATCAGTTCTCTATCGG - Intergenic
1089450250 11:118589729-118589751 TTATTTGAGCAGCCCCCTATTGG + Intronic
1090040531 11:123286962-123286984 TTATCCAACCAATCCCCTATTGG - Intergenic
1092647548 12:10592674-10592696 ATATTTAACAACTTTCCTATTGG - Intergenic
1092931045 12:13316124-13316146 TTCTTTAACCAATCCCCTGTAGG + Intergenic
1093415915 12:18920544-18920566 TTATTTAACCAGTCACCTGCTGG + Intergenic
1093458812 12:19389750-19389772 TTATTTAACCAGTTCGCTGCAGG - Intergenic
1093819813 12:23600367-23600389 TTATTTAATTTGTTCCCTTTTGG - Intronic
1093937861 12:25020207-25020229 TCATTTAATCAGTTTCCTGTTGG + Intergenic
1095153804 12:38827579-38827601 TTATTTATCCAGTCCACCATTGG - Intronic
1095607173 12:44083055-44083077 TTATTTATCCATTTTTCTATCGG + Intronic
1096625505 12:52893107-52893129 TTACTTAACCAGTCCTCTATTGG - Intergenic
1096681416 12:53257976-53257998 ATTTTTAATCACTTCCCTATGGG - Intergenic
1097010148 12:55947614-55947636 ATTTATAAACAGTTCCCTATTGG + Intronic
1097089861 12:56496442-56496464 TTATTTAACAAATTCCCTATTGG + Intergenic
1097238821 12:57559106-57559128 TTATTTAACCAGGCCTCTGTTGG + Intronic
1097390189 12:59002129-59002151 TTGTTTATCCATTTACCTATTGG - Intergenic
1098617224 12:72542284-72542306 TTATTAAAGCAGCACCCTATAGG - Exonic
1101316561 12:103634071-103634093 TTATTCAACCAATTTCCTACTGG - Intronic
1102431213 12:112884500-112884522 TTATTTAGCCAATTCCCTTTGGG + Intronic
1102760222 12:115378686-115378708 TTATTTAACCAGTCTCCTACTGG + Intergenic
1102894873 12:116590883-116590905 TTATATAACCAGTCCCTTGTTGG + Intergenic
1103632973 12:122277728-122277750 TAATTTAGTCAGTTCCCTATTGG - Intronic
1104593440 12:130103137-130103159 TTATTTAAACAGATCCTGATGGG - Intergenic
1105565931 13:21548068-21548090 TTATTTAATTGGTTCCCTAATGG - Intronic
1106282110 13:28283931-28283953 TTTATTCCCCAGTTCCCTATAGG + Intronic
1107060625 13:36155945-36155967 TTATTTAATCAGTTCATCATAGG - Intergenic
1107575603 13:41717377-41717399 TTACTTAACTAATTCTCTATTGG - Intronic
1108444887 13:50498288-50498310 TTATTTAACCATTCCCCTATTGG + Intronic
1108595729 13:51947062-51947084 TTAATTAACCAATTCCGTATTGG - Intronic
1108726758 13:53191540-53191562 TGACTTAACCAGTTCCCTTAAGG + Intergenic
1109977132 13:69853225-69853247 TTATTTAACTACTTCCCACTGGG - Intronic
1111395044 13:87655548-87655570 TTATTTATCCATTTGCCTGTTGG + Intergenic
1111883357 13:93986972-93986994 TAATTTATCCAGTTCCATGTTGG + Intronic
1112724464 13:102286581-102286603 TTATTTAACAAGTACCCATTAGG - Intronic
1113502578 13:110788680-110788702 TGATTTAGTCAGTTCTCTATTGG - Intergenic
1114243488 14:20891355-20891377 TTATTTAAACAGTTCCAAGTAGG + Intergenic
1114250428 14:20955440-20955462 TTATTTAAACAGTTCCAAGTAGG + Exonic
1114794033 14:25692017-25692039 TTATTTTACCAAGTGCCTATTGG - Intergenic
1114858831 14:26490238-26490260 TTATTTATCCATTTACCTGTTGG + Intronic
1116782174 14:49248543-49248565 TTATTTAGCCAGTCAACTATTGG + Intergenic
1117101785 14:52355949-52355971 TTACTTCTCCAGTTCCCCATTGG + Intergenic
1118756295 14:68846526-68846548 TTATCTAACTAGTGCCCTACTGG - Intergenic
1119858441 14:77918731-77918753 TTGTTCAACCAGCTCCCTAGAGG + Intronic
1120002264 14:79315920-79315942 TTATTTAACCATCTCCCCAAAGG - Intronic
1120656374 14:87194988-87195010 TTATTTAACTAGTTCTTCATTGG - Intergenic
1121258565 14:92549640-92549662 TTTTCTCACCAGTTCCCTAAAGG - Intronic
1121548787 14:94782419-94782441 TTATTTAATTAGTACCCTACTGG - Intergenic
1121857715 14:97285364-97285386 TTATTTGACCAGTTTCCTACCGG + Intergenic
1122333258 14:100943083-100943105 TGATTTAAGCATTTCCATATTGG + Intergenic
1122513217 14:102286705-102286727 ATATTAATCCAGTTTCCTATGGG - Intronic
1202845269 14_GL000009v2_random:166301-166323 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202914667 14_GL000194v1_random:156567-156589 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202877996 14_KI270722v1_random:26148-26170 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1124562379 15:30786914-30786936 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1125394236 15:39229553-39229575 TTATTAAACCTGTCCCCTATTGG - Intergenic
1125456552 15:39865958-39865980 TTATTTAACTGGTTCCCTCTTGG - Intronic
1125890112 15:43259342-43259364 ATTTTTAACTAGTTCTCTATGGG - Intronic
1125963828 15:43856169-43856191 TTATTTAACCAGATCTCTCTTGG + Intronic
1126376956 15:48006393-48006415 TGATTTAATTAGTTCCCCATGGG + Intergenic
1126511267 15:49477564-49477586 TTGTTTATCCATTTACCTATTGG + Intronic
1126741417 15:51780039-51780061 TTATTTACCCATTTTCATATTGG + Intronic
1127283400 15:57511370-57511392 TTATTTAACTAGTACCTAATTGG + Intronic
1127742242 15:61922095-61922117 TTACTTAATAATTTCCCTATTGG - Intronic
1127777306 15:62275203-62275225 TTATTGAACCAGTTCCCTGTTGG + Intergenic
1127778013 15:62283753-62283775 ATATTTAATCAGTCCCCTATTGG + Intergenic
1127851233 15:62913646-62913668 TTATATCTCCAGATCCCTATAGG + Intergenic
1127929203 15:63580093-63580115 TTATTAAACCAGTGCCCTACTGG - Intronic
1128010297 15:64288445-64288467 TAATTGAACCACTTGCCTATAGG + Intronic
1128393861 15:67203175-67203197 TAATTTATCCTGTTCCCTTTTGG - Intronic
1128722236 15:69958561-69958583 TTACTAAGCCATTTCCCTATTGG - Intergenic
1129094672 15:73192611-73192633 GTATTTAACTAGTCCCTTATTGG - Intronic
1129484591 15:75857691-75857713 TTATTTAACCAACTCTTTATTGG - Intronic
1129488091 15:75895966-75895988 ATATTTAATCAGTCCCCTATTGG - Intronic
1129837204 15:78716924-78716946 TGACTTAACCAGTTCCCTGTTGG - Intronic
1130034678 15:80347202-80347224 TTATTTTTCCAGTCCCCTACTGG - Intronic
1130267936 15:82425670-82425692 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1130276511 15:82479623-82479645 TTATTTAACCAACTCTTTATTGG + Intergenic
1130404875 15:83589818-83589840 CTATTATACCATTTCCCTATTGG + Intronic
1130468877 15:84207020-84207042 TTATTTAACCAACTCTTTATTGG + Intergenic
1130475134 15:84259057-84259079 TTATTTAACCAACTCTTTATTGG - Intergenic
1130476367 15:84321571-84321593 TTATTTAACCAACTCTTTATTGG + Intergenic
1130482549 15:84373110-84373132 TTATTTAACCAACTCTTTATTGG - Intergenic
1130495398 15:84466559-84466581 TTATTTAACCAACTCTTTATTGG - Intergenic
1130504089 15:84521164-84521186 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1130507491 15:84559040-84559062 TTATTTAACCAACTCTTTATTGG + Intergenic
1130591171 15:85211619-85211641 TTATTTAACCAACTCTTTATTGG + Intergenic
1130919349 15:88331232-88331254 TTATTTAACCAGGCCCATCTTGG + Intergenic
1131501428 15:92970750-92970772 TTATTCAACCAGTTTCCTTGTGG + Intronic
1132183945 15:99787218-99787240 TTACTTAACCAGTTCCCATTTGG - Intergenic
1132434436 15:101785927-101785949 TTACTTAACCAATTCCCTTTTGG + Intergenic
1133969018 16:10553742-10553764 TTACTTAACTGGTTCCCTATTGG + Intronic
1134130245 16:11644414-11644436 TTATTCAACCAGTTCCTTCTTGG - Intergenic
1134395313 16:13857088-13857110 ATAGTTAACCAGTTCCCTATTGG - Intergenic
1134425062 16:14134142-14134164 TTATTTAACTTGTTCACTAGAGG - Intronic
1134468336 16:14498809-14498831 TTCTTTATCCATTTCCCTTTTGG - Intronic
1134836104 16:17362482-17362504 TTATTTAAACAGTTACCTTTGGG - Intronic
1135342690 16:21662872-21662894 TTATTTAAGCATTTCATTATTGG + Intergenic
1136395481 16:29990509-29990531 TTATTTAACCCATCCCTTATTGG + Intronic
1137465446 16:48704601-48704623 TTATTTAACCAATCCACTAAGGG + Intergenic
1137952974 16:52801077-52801099 TTAATTAACCAGTACCCTTCAGG + Intergenic
1138034024 16:53584304-53584326 TTATTTGATGAGTTCCTTATTGG + Intergenic
1138538257 16:57671773-57671795 TTTTTTAACCGGTCCCCTCTTGG - Intronic
1139423704 16:66865860-66865882 TTGTTTAACCAGGTCTCTACAGG - Intronic
1139459183 16:67108737-67108759 TTATTTAGCCACTTCCCTACTGG + Intergenic
1140386624 16:74545758-74545780 TTAGTTAACCAATACCCTCTTGG - Intronic
1141565829 16:84901081-84901103 ATATTTAACTGGATCCCTATTGG - Intronic
1141780472 16:86156873-86156895 TTTATTAAACAGTTCCCTATTGG + Intergenic
1143380774 17:6494882-6494904 TTATTTAATCTGTCCCCTACTGG - Intronic
1143425603 17:6834406-6834428 TTATTTAATCAGTCTCCTCTTGG - Intergenic
1143673608 17:8414169-8414191 TTATTAAACCAGTCTCCTATTGG + Intronic
1144113941 17:12067175-12067197 ATATTTAACTAGTTCCTTATTGG + Intronic
1144295103 17:13866926-13866948 TTATTTGACCCATTCCTTATTGG - Intergenic
1144888636 17:18480701-18480723 TTATTTCACCTTTTCCCTGTTGG + Intronic
1145143571 17:20463597-20463619 TTATTTCACCTTTTCCCTGTTGG - Intronic
1145931490 17:28689264-28689286 TTATTTAACCAGTTCCCCATTGG + Intronic
1146247356 17:31300534-31300556 TTATTCAACCAGTCCCCTATTGG + Intronic
1147860086 17:43514771-43514793 TTATTAAACTACTTCCCTTTTGG - Intronic
1148389615 17:47261944-47261966 TTACTTAACCAATTCCCTGTTGG + Intronic
1149630521 17:58118246-58118268 TTGTTTAACCAATCCCCTACTGG - Intergenic
1150036404 17:61803886-61803908 TTATTTAACATGTCCCTTATGGG - Intronic
1153386780 18:4507262-4507284 TTCTTTATCTAGTTCTCTATAGG - Intergenic
1153630691 18:7066987-7067009 TCATTTAACCTGTTCCCATTGGG - Intronic
1153902665 18:9631957-9631979 TTGTTTAATAAGTTCTCTATTGG - Intergenic
1154488184 18:14895628-14895650 TTGTTTATCCATTTACCTATTGG - Intergenic
1154629710 18:16769911-16769933 GCATTTAACCAGTTCCCTGTAGG - Intergenic
1155017056 18:21854040-21854062 TTAGTTGACCAGCTGCCTATTGG - Intronic
1155444577 18:25897776-25897798 TTATTTGGTCATTTCCCTATTGG + Intergenic
1155963079 18:32011557-32011579 TTATTTAACCAGTCACCTATTGG + Intergenic
1156318020 18:35989235-35989257 TTATATAGCAAGTTCCTTATGGG - Intronic
1157558014 18:48625737-48625759 TTATTTAACCATTTGCTTAATGG + Intronic
1157738688 18:50073306-50073328 TTATTTTGCCAGTTCCATCTGGG - Intronic
1157785433 18:50477755-50477777 TTATTGAACCAGTCCCCTATTGG - Intergenic
1158302778 18:56070812-56070834 TTACTTAAACAGATCCCTCTGGG - Intergenic
1158635819 18:59156475-59156497 TTATTTAACCAATCCCCTTTTGG + Intronic
1159526278 18:69594959-69594981 TTTTTTAACTAGTTCATTATTGG - Intronic
1162810437 19:13161465-13161487 TTATTTAACCAGTCTCTGATGGG + Intergenic
1167833878 19:52050271-52050293 TTTTTTGACAAGTGCCCTATGGG + Intronic
1202672681 1_KI270710v1_random:6781-6803 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1202685751 1_KI270712v1_random:48368-48390 TTATTTAACCAGTCTCCTTTAGG - Intergenic
925159070 2:1670237-1670259 TTATTTAACAAGTTCTCTTTTGG - Intronic
925361777 2:3285029-3285051 GTATTTAACCACTTCTCCATTGG - Intronic
925551575 2:5081545-5081567 TTTTTTAATGACTTCCCTATTGG - Intergenic
926545754 2:14237195-14237217 TTATTTAACAAGTTCCAGATGGG + Intergenic
926902430 2:17768105-17768127 TTATTTAACCAGTACACACTAGG - Intronic
927244679 2:20948027-20948049 TTATTGAATTAGTTCTCTATGGG + Intergenic
928023018 2:27718468-27718490 TTACTTAACCATTTCCTTATTGG - Intergenic
928047587 2:27952956-27952978 TTCTTTAGCCAGTTCTATATTGG + Intronic
928961198 2:36927966-36927988 TTATTTAACCAGTCTCCTTTAGG - Intronic
929957403 2:46469036-46469058 TTGTTTAACCAGATCCCTTCTGG + Intronic
930382778 2:50652905-50652927 GGTTTTAACCATTTCCCTATTGG + Intronic
931487098 2:62705157-62705179 TTATTTCACCAGTTCCTCCTGGG - Intronic
931655519 2:64507908-64507930 TTATTTACCCATCTCCCTACAGG + Intergenic
932211455 2:69934821-69934843 TTATTTAACCAGTTCCCTCCTGG + Intronic
932333054 2:70910658-70910680 ATATTTAGCCATTTCTCTATCGG + Intronic
932374131 2:71220058-71220080 TTACTTAACCAGTTCCCTGATGG + Intronic
933109604 2:78380881-78380903 TTATTTAACCAGTCTCCTACTGG - Intergenic
934245973 2:90306456-90306478 TTATTTAACCAGTCTCCTTTAGG + Intergenic
934262773 2:91490579-91490601 TTATTTAACCAGTCTCCTTTAGG - Intergenic
934706905 2:96487856-96487878 TGATATAACCACTTTCCTATTGG + Intergenic
935938222 2:108209489-108209511 TTATTCAAAAAGTTGCCTATGGG - Intergenic
936740785 2:115504962-115504984 TTATTCATACAGTTCCCCATAGG + Intronic
937165421 2:119810715-119810737 TTATTTCACCTTTTCCATATAGG - Intronic
937483592 2:122290324-122290346 TTATTTATCCATTTTCCTCTTGG + Intergenic
938402164 2:131002925-131002947 TCATTAAAACAGTTCCCTTTAGG - Intronic
940308600 2:152253117-152253139 TTATTTAACCAGCTACGAATTGG - Intergenic
940494702 2:154411418-154411440 TTATTTAACCATTCCCCTCTTGG - Intronic
941434673 2:165454460-165454482 TTATTTTGTCAGTTCCCTCTTGG + Intergenic
941634733 2:167924369-167924391 CAATTTAACCCATTCCCTATTGG - Intergenic
941648922 2:168072018-168072040 TTATTTAACCATTTCCTTCTTGG - Intronic
941652273 2:168104899-168104921 TTATTTAACCTGTCCCTTGTTGG - Intronic
942040863 2:172060706-172060728 ATATTTAATCAGTCCCCTACTGG + Intronic
942089828 2:172479106-172479128 TTATTTAACCAGTACCTAATCGG - Intronic
942568662 2:177291346-177291368 CTATTTAACTAGTTTCCTATAGG + Intronic
943857578 2:192817705-192817727 TTATTTAACCATTTCCTTGGAGG + Intergenic
944536509 2:200715751-200715773 TTATTTAACCAATCCCCATTTGG + Intergenic
944882922 2:204032978-204033000 TTATTTCACCAATCTCCTATGGG + Intergenic
944925184 2:204456917-204456939 TTATTTTACAAGTTCCACATTGG + Intergenic
945050595 2:205820615-205820637 TTATTTAGTGAGTTCCCTACTGG - Intergenic
945270716 2:207936820-207936842 TTATCTAACCAGTTCTTTTTTGG - Intronic
945280663 2:208032647-208032669 ATATTGAAACAGTTCCATATGGG + Intergenic
945832209 2:214801250-214801272 TCATTTAACCATTTCCTTATTGG - Intronic
945840885 2:214886959-214886981 TTTTTTAACTAGTTTCCTCTAGG - Intergenic
945954634 2:216074887-216074909 TTATTTAACCATTTCCTGAATGG - Intronic
946250694 2:218409893-218409915 GTATTTAACCAGTTCTTTATTGG - Intergenic
946505133 2:220291511-220291533 TTATCTAATCAGTTCCCTTTTGG + Intergenic
946579032 2:221106630-221106652 ATACTTTTCCAGTTCCCTATTGG + Intergenic
946835572 2:223769116-223769138 TTATTTAAGCAGTTCCTTTATGG + Intronic
946896829 2:224332540-224332562 TTTGTCAACCAGTTCCCTATAGG - Intergenic
946913981 2:224496553-224496575 TTATTTTAACAGTACACTATGGG + Intronic
946950314 2:224867291-224867313 TTGTTCAACCAGTTACTTATTGG + Intronic
1169005117 20:2200413-2200435 TTATTTACCCAGTTCCCTATTGG + Intergenic
1169282948 20:4282477-4282499 TTAATTAACCAGTTCTCTACAGG + Intergenic
1169726002 20:8732492-8732514 GTATTTAACCATTCCCCTTTTGG - Intronic
1170674801 20:18468954-18468976 TTATGTCACCAGTTCCCTCATGG + Exonic
1171117650 20:22539831-22539853 TTTTTTAACCAGTCCATTATGGG - Intergenic
1173022948 20:39283231-39283253 TTTTTTAACAAGTCCCCTAGAGG - Intergenic
1173139431 20:40469476-40469498 CTATATAACTAGTTCCCTTTAGG + Intergenic
1173237398 20:41259479-41259501 TAATTTAGCCAGTTCCCTGTTGG - Intronic
1173506764 20:43593504-43593526 TTATTTAACCAGTCATCTACTGG - Intronic
1173900588 20:46585041-46585063 TTATTTAACCAATTCCTTATTGG - Intronic
1174211812 20:48885662-48885684 TTATTCATCCATTTGCCTATTGG - Intergenic
1174222402 20:48967331-48967353 TCTATTAACCAATTCCCTATTGG + Intronic
1175097707 20:56554798-56554820 TAATTTAACCAGTTCCCTACTGG + Intergenic
1176634020 21:9171212-9171234 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1176639295 21:9283609-9283631 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1176699806 21:10031964-10031986 TTACTTAGCCATTTCTCTATTGG - Intergenic
1176793090 21:13343705-13343727 TTGTTTATCCATTTACCTATTGG + Intergenic
1177634152 21:23765402-23765424 TTAATTTACCAGCTCCGTATGGG + Intergenic
1178862801 21:36303513-36303535 TTATTTAGCCAGTCTCCTACTGG - Intergenic
1179177568 21:39020147-39020169 TTATTTAACAACCTCCTTATAGG - Intergenic
1179401539 21:41089072-41089094 TTATTTAATCAGTTCCTCATTGG - Intergenic
1180372595 22:12056440-12056462 TAATTTCACCAGATCCCTGTGGG + Intergenic
1180389882 22:12219223-12219245 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1180416056 22:12715257-12715279 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1180423340 22:12891098-12891120 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1182971449 22:34582005-34582027 ATATTTAACTAGTATCCTATTGG - Intergenic
1185174013 22:49309130-49309152 TTATATAATCAGTCCCCTATTGG + Intergenic
949090935 3:28298-28320 TTGTTTAGTCATTTCCCTATTGG + Intergenic
950629229 3:14271041-14271063 TTATTTAACCAGTTCCCTGTTGG + Intergenic
951000481 3:17553901-17553923 AAATTCAACAAGTTCCCTATTGG - Intronic
951029453 3:17864799-17864821 TTATTTAACCATTCCTTTATTGG + Intronic
953290698 3:41658556-41658578 TGATTTAACAAGTCCCCTTTAGG - Intronic
953511973 3:43551102-43551124 TTATGTAACCATTTTCTTATTGG + Intronic
954336969 3:49924366-49924388 TTATTTACACAGTGTCCTATTGG - Intronic
955343608 3:58144488-58144510 ATATTTGACCATTTCCCTATTGG + Intronic
956024224 3:64965158-64965180 TTGTTTATCCATTTACCTATAGG + Intergenic
956640764 3:71413305-71413327 TTATTTAGCCAGTTCCATACTGG - Intronic
957013574 3:75036773-75036795 TTATTTATCCAGTCCACCATTGG + Intergenic
957031254 3:75244506-75244528 TTGTTTAGTCATTTCCCTATTGG + Intergenic
959123358 3:102259715-102259737 TTATTTAACCAGTTCTGTATTGG + Intronic
959376862 3:105598687-105598709 TGAGTTAATCAGTTCCCTATTGG + Intergenic
961767412 3:129222152-129222174 TTATTTACCCATTTTTCTATTGG - Intergenic
963294509 3:143530791-143530813 TGATTTAACCAGTGTCATATTGG + Intronic
963997246 3:151723978-151724000 TTCTTTAACCAGTCACCCATAGG + Intergenic
965004491 3:163001625-163001647 TTATTTTAACAGTTTCCTTTTGG + Intergenic
965039914 3:163493274-163493296 TTATTTATTCATTTACCTATTGG - Intergenic
966214066 3:177483245-177483267 GCATTTAACCATTTTCCTATGGG - Intergenic
966587777 3:181646505-181646527 TTATTTAGCCAGTCCCCTGTTGG - Intergenic
967970738 3:194997218-194997240 TTATTTAACCAATGCCCTATTGG - Intergenic
968263748 3:197346064-197346086 TTACTTAACCACTTCTTTATTGG + Intergenic
1202747600 3_GL000221v1_random:121418-121440 TAATTTCACCAGCTCCCTGTGGG - Intergenic
970518135 4:16854871-16854893 TTATTTAAGCTTTGCCCTATTGG + Intronic
971409657 4:26356695-26356717 ATATTTAGCCAGTTCCCATTTGG + Intronic
972297245 4:37751778-37751800 GTATTTAACCAGTCCTCTACTGG + Intergenic
972542262 4:40049483-40049505 GCATTTAACCAGTTCCCTGTAGG + Intergenic
973694211 4:53474138-53474160 TTATTTAACCAGTTCCTAATTGG + Intronic
974516738 4:62924324-62924346 GTATTTTACCAATTCCCTAATGG + Intergenic
974910616 4:68114707-68114729 TTTTTTTTCCAGTTCCCTTTGGG - Intronic
975743851 4:77456648-77456670 TGATTTAACCACTTCCCCAGAGG + Intergenic
976271616 4:83236181-83236203 GTATTTAATCAATTCCCTCTAGG - Intergenic
976440910 4:85073417-85073439 TTATCTTTCCAGTTCCCTAAGGG - Intergenic
976768145 4:88620170-88620192 TTATTCAACCTATTCCCTAGAGG - Intronic
976980610 4:91221910-91221932 TTATTTAACAATTTCCCTTTCGG - Intronic
977375065 4:96192092-96192114 TTATTTCACCAATTCTCTCTTGG + Intergenic
977610866 4:99029264-99029286 TCATTTAACCAGATTCCTTTTGG + Intronic
977955701 4:103023271-103023293 TTATTAAATCAGCTCCCTATGGG - Intronic
978383330 4:108153777-108153799 TTATTTAACCAGTATTTTATTGG - Intronic
978414151 4:108457987-108458009 TTATTTAACTAGTCCGCTATTGG - Intergenic
979706774 4:123729405-123729427 TTCTTTATCCAATTCACTATTGG + Intergenic
979971901 4:127145899-127145921 TTTTTTTACCTGTTCCCTAGGGG - Intergenic
980414792 4:132472346-132472368 ATTATTAACCTGTTCCCTATGGG - Intergenic
980493756 4:133563894-133563916 TTGTTTATCCATTTCCCTAGTGG - Intergenic
980576577 4:134690019-134690041 CTATTAAATCAGTTGCCTATTGG + Intergenic
980636026 4:135504492-135504514 TTGTTTATCCATTTACCTATTGG - Intergenic
982046638 4:151453968-151453990 ATATTTAGCCACTTCCTTATGGG + Intronic
982841250 4:160189941-160189963 TTATATAACTAATTTCCTATTGG + Intergenic
983559849 4:169089751-169089773 CCATTTAACCATTTCCATATTGG + Intergenic
984088145 4:175337338-175337360 TTATTTAACCAATTTTATATTGG + Intergenic
1202754187 4_GL000008v2_random:42001-42023 TAATTTCACCAGCTCCCTGTGGG + Intergenic
986412751 5:7497812-7497834 TTATTTAACCAGTTACCAGTCGG + Intronic
987538865 5:19227462-19227484 CTGTTTAACCAGTTACATATTGG - Intergenic
990255760 5:53966947-53966969 TTATTGAACTAGTGCCCTAAAGG - Intronic
990566419 5:57033966-57033988 TTATTTAACTACTTCTCTATTGG - Intergenic
990662064 5:58027185-58027207 GTATTTACCCAGTTCCGTCTTGG + Intergenic
990815417 5:59779723-59779745 TCATTTAGCCATTTCCCTACTGG + Intronic
990984988 5:61632907-61632929 TCATTTACCCTGTTCCCTCTTGG + Intergenic
991071582 5:62488631-62488653 TTATTTACTCATATCCCTATAGG - Intronic
991098775 5:62768462-62768484 TTATTTAACCAGACTCCCATTGG + Intergenic
992300752 5:75377476-75377498 TTATTTAATCAGTTCTGCATTGG - Intronic
993820252 5:92605620-92605642 TTATTTAAACAGTTTGCTATAGG + Intergenic
993829184 5:92732283-92732305 ATATTTTACCTGGTCCCTATGGG - Intergenic
993894316 5:93513423-93513445 TTCTTTATCCAATTCACTATTGG - Intergenic
994561838 5:101383864-101383886 TTTTTCAACCAGTACCATATGGG - Intergenic
995121200 5:108536693-108536715 TTATTTTACCAGTCCACTACTGG + Intergenic
995296258 5:110526810-110526832 TTATTTAACCAATTTTCTATTGG - Intronic
995376262 5:111477493-111477515 TTTTTTAAGCAGTTCCCTCTTGG + Intronic
995392277 5:111652645-111652667 TGATTCAACCACTTCCCTCTGGG + Intergenic
996510738 5:124313250-124313272 TTCTTTACCCACTTCCCTCTTGG + Intergenic
997319449 5:132965256-132965278 TTATTTAACCAATCCCCTACAGG + Intergenic
998365699 5:141629422-141629444 TAATGTCACCAGTTCCCTAAAGG + Intronic
998978440 5:147673755-147673777 TTATTTATCCTTTTGCCTATTGG - Intronic
999116425 5:149168150-149168172 CTAGTTCACCAGTTCTCTATTGG - Intronic
999569713 5:152905877-152905899 TTATTTAATAAGATCCCTAAGGG + Intergenic
999726701 5:154444537-154444559 TTACTTAACCACTTCCCTTTTGG + Intergenic
999815895 5:155175723-155175745 TCATTTAACCAGTGACCTATTGG - Intergenic
999831131 5:155321191-155321213 TTATTCAACCAATTGCCTACTGG - Intergenic
1000494285 5:161959788-161959810 TTATTTACTCAATTCCATATTGG - Intergenic
1000851029 5:166340570-166340592 CTATTTAATCATTTCCATATTGG + Intergenic
1001047055 5:168382109-168382131 TTATTTAACCAGACCTCGATGGG - Intronic
1001646803 5:173288141-173288163 TTTTTAAACCAGTCCCCTGTAGG - Intergenic
1002077788 5:176719452-176719474 TTAGTTAACCAGTCCCCTACCGG + Intergenic
1002477214 5:179474373-179474395 TTATTCAGCCAGCTCCCCATGGG + Intergenic
1003073792 6:2965771-2965793 TTATTTTAACAGTTTCCTATGGG + Intronic
1003199518 6:3946266-3946288 TTATTTCACCATTTTCCTATTGG + Intergenic
1003351533 6:5322193-5322215 TTATTTTATCATTTCCCTATTGG - Intronic
1004403372 6:15309467-15309489 TAATTTAACCAATCCCCTATTGG - Intronic
1005088364 6:22030494-22030516 TCATTTTACCATTTCCCTATGGG + Intergenic
1005720446 6:28596219-28596241 TTATTTAACCAGTTCTCTGTTGG - Intronic
1005949166 6:30618474-30618496 TTATTAAATCAGTTTCTTATCGG + Intronic
1006198796 6:32267040-32267062 TTATTTAAACACTCCCCTGTAGG - Intergenic
1006872698 6:37266800-37266822 TTATTTAACTACTTTCCTGTTGG + Intronic
1007603311 6:43097293-43097315 TTATTTCACCAGTGCCCTACTGG + Intronic
1007634699 6:43292133-43292155 CTATTTAACCAGCTCCATATTGG + Intergenic
1008222381 6:48871351-48871373 TTATTTAGCCTGTTTTCTATCGG + Intergenic
1009276257 6:61684615-61684637 TTATTTTATCATTTCCCTAAAGG - Intronic
1009446369 6:63747198-63747220 TTATTTACCCAGTAGCCAATTGG + Intronic
1009955010 6:70442904-70442926 TTATTCAACCAGTCCCCTATTGG + Intronic
1010091541 6:71988583-71988605 TTATTCAGCCATTTTCCTATGGG - Intronic
1011057514 6:83221347-83221369 GTATTTAAGCAGTACCCTAAAGG + Intronic
1011709632 6:90039165-90039187 TTATATAACCAATTCTCTATTGG + Intronic
1011802074 6:91028369-91028391 TTTTTTAATCAATTTCCTATCGG - Intergenic
1012280621 6:97323624-97323646 TTTTATAACCAGTTCTCTAGGGG - Intergenic
1012365239 6:98430882-98430904 TTATTTAACCTTTACCCTATTGG - Intergenic
1012409884 6:98945252-98945274 TTATTTAGCCAGTCCCCTGTTGG - Intronic
1012770665 6:103429476-103429498 TTCTTTAACCAGTCCACTGTTGG - Intergenic
1013981181 6:116131610-116131632 TTTTTCAACCATTGCCCTATAGG + Intronic
1014053830 6:116989696-116989718 TGAGTTAAGCAGTTCCATATGGG + Intergenic
1014171353 6:118282566-118282588 TTATATATCCAGCTCCCTACTGG + Intronic
1015470984 6:133606174-133606196 TAAGTTAACCAGTCCTCTATTGG - Intergenic
1016129612 6:140450268-140450290 TTGTTTAGCCATTTGCCTATTGG + Intergenic
1016278982 6:142391068-142391090 TTATTTAACCAGTATCCTATTGG + Intronic
1016819330 6:148333147-148333169 TTTTTTAACAAGTTCCCCAGAGG - Intronic
1017560205 6:155619199-155619221 TAATTTAACTAGTCTCCTATAGG + Intergenic
1018695141 6:166384725-166384747 TTATTTAACTCTCTCCCTATGGG - Intergenic
1020977942 7:15031029-15031051 TTATTCAATCAGTGACCTATGGG + Intergenic
1021207683 7:17805660-17805682 TCATTTAACCAGTTCATAATAGG - Intronic
1021466662 7:20951860-20951882 TAATTTAACCAGTCCACTGTTGG - Intergenic
1022007608 7:26280597-26280619 TTATTTAAACATTTCTGTATTGG + Intergenic
1022684657 7:32585076-32585098 TTTTTTAAACAGTTTTCTATTGG + Exonic
1023013121 7:35940830-35940852 GTATTTACCCAGTTCTCTACAGG - Intergenic
1023240234 7:38137235-38137257 TTGTTTAACCATTTACCCATTGG - Intergenic
1024454783 7:49592529-49592551 TTATTCATCTAGTTCCCTACTGG - Intergenic
1025126403 7:56348416-56348438 GTATTTACCCAGTTCTCTACAGG - Intergenic
1025640332 7:63361386-63361408 TAATTTTACCATTTTCCTATTGG + Intergenic
1025642367 7:63386707-63386729 TAATTTTACCATTTTCCTATTGG - Intergenic
1025888627 7:65623458-65623480 TTACTGACCCAGTTCCCTAGGGG - Intergenic
1026325867 7:69309864-69309886 TTATTTCACCAGTCCTCTCTTGG - Intergenic
1027424964 7:78052917-78052939 TCATTTAAGCAGTCTCCTATTGG - Intronic
1028924039 7:96338196-96338218 TCATTTAAACAATGCCCTATAGG - Intergenic
1029969793 7:104777916-104777938 TTACTTCACCAGTTTCTTATTGG + Intronic
1031433280 7:121699987-121700009 TTATTTTAGCAGTTACCTAGTGG + Intergenic
1031853819 7:126898498-126898520 TTACTGACCCAGTTCCCTAGGGG + Intronic
1032882119 7:136100975-136100997 TGATTTAATCATTTCCCAATGGG - Intergenic
1033836402 7:145317507-145317529 TTATTTAACCAGTCTCCTATTGG + Intergenic
1034392484 7:150797818-150797840 TTATTTAAGTGGTTCCCTATTGG + Intronic
1034548382 7:151804226-151804248 TAGTTTAACCAGTCCCCTGTAGG + Intronic
1034790997 7:153967943-153967965 TTCTTTATCCAGTTCACCATTGG + Intronic
1034820634 7:154213329-154213351 TCATATAACCAGTTTCCTAGAGG + Intronic
1035980603 8:4366311-4366333 TTCTTTAGCCAGTTCACCATTGG + Intronic
1036164935 8:6423571-6423593 TTATGTAAGCAGTGTCCTATTGG + Intronic
1036540837 8:9708063-9708085 TTATTTAACTGGTTTCCTTTTGG + Intronic
1036724277 8:11205633-11205655 TTATTTAACTAGTTCCCCTTTGG - Intergenic
1037849758 8:22317547-22317569 TTATTTAACCAATCCTCTCTTGG + Intronic
1038554622 8:28499401-28499423 TTATTTAACCAATTTCTTATTGG + Intronic
1039017393 8:33166909-33166931 TTATTTAGCCAGTTCTCTATTGG - Intergenic
1039562231 8:38521887-38521909 TTATTTAATCATTTACCAATGGG + Intronic
1040973331 8:53161795-53161817 TTCTTTAACCAGTTGACCATTGG + Intergenic
1041194902 8:55391366-55391388 TTATTCAACTAGTTCCTTAGTGG - Intronic
1041744644 8:61194575-61194597 TTATTTATCTATTTCCCTTTGGG - Intronic
1041908681 8:63063799-63063821 TTATTTAACCAATGCCCTAATGG + Intronic
1042037419 8:64550659-64550681 TTATTCAACCAGTCCTCTCTTGG + Intergenic
1042359348 8:67864847-67864869 TTATTTCACCATTTTCCTTTTGG - Intergenic
1042944545 8:74142133-74142155 TAATTTAACCCAGTCCCTATTGG + Intergenic
1043019981 8:74988404-74988426 TTGACTAACCAGTTACCTATTGG + Intronic
1043112622 8:76206774-76206796 TTATTTATCCACTTCAGTATGGG + Intergenic
1043447283 8:80331311-80331333 TGGTTTAACCAGTGCCCAATAGG - Intergenic
1043626033 8:82259777-82259799 TTATTTAACCTTTTCCATGTAGG + Intergenic
1044983584 8:97738988-97739010 TTACTTAACCATTTCCCTATTGG + Intergenic
1045008739 8:97938564-97938586 TTATTTGGCCATTTCCCCATTGG - Intronic
1045731393 8:105246034-105246056 TTATTAAGCCAGTTGCTTATAGG - Intronic
1046462729 8:114563329-114563351 TTATTTAAATAGTCCCTTATTGG + Intergenic
1047161161 8:122381544-122381566 TTATTTAACCAGTTCATGAGGGG - Intergenic
1047241931 8:123098672-123098694 TTTTTAAACCAGTCTCCTATTGG + Intronic
1047322876 8:123804770-123804792 TTAGTTAACCAGTCCCCTGTTGG + Intronic
1047339315 8:123965232-123965254 TAACTTAATCAGTTCTCTATTGG + Intronic
1047707933 8:127520658-127520680 TGATTTAACCATTTACCTATTGG - Intergenic
1048636817 8:136305823-136305845 TTATTTTGCCAGTTCCTTCTTGG + Intergenic
1049946028 9:596667-596689 TTACTTTACCAGTTCCCCATTGG + Intronic
1050278235 9:4022673-4022695 TTGTTTATCCACTTCCCTGTGGG - Intronic
1050427534 9:5526896-5526918 TTATTTAACCACTTCCCTGTTGG + Intronic
1052060710 9:23957966-23957988 TTATTAAACCAGTATCATATAGG + Intergenic
1052105391 9:24509014-24509036 TTGTTTATCCAGTTACCTAATGG + Intergenic
1053621537 9:39824467-39824489 TTGTTTATCCATTTACCTATTGG - Intergenic
1053636955 9:40018433-40018455 TTACTTAGCCATTTCTCTATTGG - Intergenic
1053769074 9:41446469-41446491 TTACTTAGCCATTTCTCTATTGG + Intergenic
1054317784 9:63615226-63615248 TTACTTAGCCATTTCTCTATTGG - Intergenic
1054547745 9:66357970-66357992 TTACTTAGCCATTTCTCTATTGG + Intergenic
1055061055 9:72069280-72069302 TTATTTAAGCCGTTCAATATAGG - Intronic
1055081260 9:72269559-72269581 GTATTTAACCAGTGCCTTGTTGG - Intergenic
1055515253 9:77027091-77027113 TTATTTAAACATTTCCCTATGGG - Intergenic
1056500830 9:87207513-87207535 AACTTTAACCAGTTCCCTCTTGG - Intergenic
1056846514 9:90042548-90042570 TTATTTAAGCATTTTCCTGTTGG - Intergenic
1057073014 9:92116351-92116373 TTATGTAAACGTTTCCCTATTGG + Intergenic
1057389519 9:94631015-94631037 TTCTTTTGCCAGTTCCTTATTGG - Intronic
1058030666 9:100193961-100193983 TTGTTTAACCATTTGCCTGTTGG + Intronic
1058310953 9:103501942-103501964 TCTTTTAAACAGTTGCCTATAGG + Intergenic
1058593525 9:106590251-106590273 ATACTTAACTATTTCCCTATTGG - Intergenic
1058793868 9:108478287-108478309 TTATTTTACCAGGTTCCTGTAGG + Intergenic
1058936601 9:109775167-109775189 TTATCTACCCAGTTTCCTCTAGG + Intronic
1059629941 9:116110604-116110626 TTCTTTATCCAGTCCCCCATTGG - Intergenic
1061057037 9:128229041-128229063 TTACTTAACCATTTTCCTATTGG - Intronic
1061634329 9:131897154-131897176 TTCTTTAACCATTCTCCTATTGG + Intronic
1202784819 9_KI270719v1_random:2023-2045 TTACTTAGCCATTTCTCTATTGG - Intergenic
1203756865 Un_GL000218v1:138848-138870 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1203716236 Un_KI270742v1:151509-151531 TAATTTCACCAGCTCCCTGTGGG - Intergenic
1203534979 Un_KI270743v1:26726-26748 TAATTTCACCAGCTCCCTGTGGG + Intergenic
1185979762 X:4764686-4764708 TTATTTAACCATTTTTGTATGGG + Intergenic
1186774065 X:12846592-12846614 TTACTTAACCATTTCTCTAACGG - Intergenic
1187165985 X:16804308-16804330 TTATTTAACCAGTTCCCTATTGG + Intronic
1187282663 X:17870941-17870963 TTATTTAACCATTAACCTGTTGG + Intergenic
1187544926 X:20240697-20240719 TTATTTAACCAGTCCCTTGTTGG - Intronic
1187956120 X:24520801-24520823 TTATTTAACTGTTTTCCTATGGG + Intronic
1188302069 X:28516660-28516682 TTATTTAACAAATTCTCTACTGG + Intergenic
1188714689 X:33447561-33447583 TTATTTATCCAGTTTCTTACTGG + Intergenic
1188866707 X:35321803-35321825 TTTGTTAACCTATTCCCTATAGG + Intergenic
1189024592 X:37379495-37379517 TTATTTAATCAGTCCTCTATTGG - Intronic
1190616748 X:52241938-52241960 TTATTTAAACACTCCCCTGTTGG + Intergenic
1192216140 X:69159893-69159915 TTATTTATCCATTTCCCTACTGG - Intergenic
1192413169 X:70953186-70953208 TTATTTAACTAGTTCCATACTGG - Intergenic
1193254808 X:79335227-79335249 TTATTTATCCAATTCTCTGTTGG + Intergenic
1195236230 X:102901336-102901358 TTATTCAATCAATTCCTTATTGG + Intergenic
1195594323 X:106671339-106671361 TTATTTGACCAGTCTCCTACTGG + Intronic
1195892160 X:109707732-109707754 TTATTTTACCAATCACCTATTGG - Intronic
1196318201 X:114254838-114254860 TTATTTAACAAGCTCCCTGAGGG - Intergenic
1196786869 X:119428555-119428577 TTATTTAACTAGTCCCTGATTGG + Intronic
1197577075 X:128227657-128227679 TTCTTTATCCATTTCTCTATTGG - Intergenic
1198536967 X:137595890-137595912 TTATTTTACCAGTGCTCCATCGG + Intergenic
1202365817 Y:24163432-24163454 TTACTTAACCAGTTCCCTGTTGG - Intergenic
1202504965 Y:25506690-25506712 TTACTTAACCAGTTCCCTGTTGG + Intergenic
1202587900 Y:26451218-26451240 TTATTTAAGCAGTCTCCTTTAGG + Intergenic