ID: 1187169210

View in Genome Browser
Species Human (GRCh38)
Location X:16834937-16834959
Sequence CACAAGCGATCCTGCCGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38738
Summary {0: 1, 1: 9, 2: 356, 3: 5379, 4: 32993}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187169210_1187169213 -4 Left 1187169210 X:16834937-16834959 CCGAGGCGGCAGGATCGCTTGTG 0: 1
1: 9
2: 356
3: 5379
4: 32993
Right 1187169213 X:16834956-16834978 TGTGCTGGTGTTTTTCATCAGGG 0: 1
1: 0
2: 0
3: 14
4: 201
1187169210_1187169212 -5 Left 1187169210 X:16834937-16834959 CCGAGGCGGCAGGATCGCTTGTG 0: 1
1: 9
2: 356
3: 5379
4: 32993
Right 1187169212 X:16834955-16834977 TTGTGCTGGTGTTTTTCATCAGG 0: 1
1: 0
2: 2
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187169210 Original CRISPR CACAAGCGATCCTGCCGCCT CGG (reversed) Intronic
Too many off-targets to display for this crispr