ID: 1187172150

View in Genome Browser
Species Human (GRCh38)
Location X:16862503-16862525
Sequence CTGTAGGCACTGGTATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187172150_1187172154 20 Left 1187172150 X:16862503-16862525 CCTTCCTATACCAGTGCCTACAG 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1187172154 X:16862546-16862568 AAATTTTTTTTTTAAATTTTTGG 0: 1
1: 13
2: 164
3: 1275
4: 8822

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187172150 Original CRISPR CTGTAGGCACTGGTATAGGA AGG (reversed) Intronic
902122102 1:14175037-14175059 CTGTAGGCATTGGTTTAGAGAGG + Intergenic
907631245 1:56084379-56084401 CTGTAGGCCCTGGCCTAGGGTGG + Intergenic
908975811 1:69896670-69896692 ATAAAGGCAATGGTATAGGAAGG - Intronic
915414415 1:155729660-155729682 CTGTAGTCACTGCTACTGGAAGG + Intronic
915923056 1:159992525-159992547 CTGTAGGCACTGGGATGTGGTGG - Intergenic
918645501 1:186899494-186899516 CTGAAGGCACTGGACTAGAAAGG + Intronic
920368140 1:205459110-205459132 CTGAAGGCTCTGGTAGAGGCAGG - Intergenic
924591403 1:245407885-245407907 CTGTAGGCCCTGGGATTGCATGG + Intronic
1067014077 10:42742736-42742758 CTGAAAACACTGATATAGGAGGG - Intergenic
1070819324 10:79345844-79345866 CAGGATGCACTGGTAGAGGAAGG + Intergenic
1071119055 10:82256782-82256804 CTTTAGGCAATGGAAGAGGAAGG + Intronic
1071411999 10:85406299-85406321 CTGTAGGCCTTGGTGTGGGAAGG - Intergenic
1075894046 10:125979017-125979039 CTGAAGGCACTGGTAGAGAGGGG + Intronic
1076372837 10:129966016-129966038 CGGCAGACACTGGTGTAGGAGGG + Intergenic
1077253066 11:1569135-1569157 CCCTAGGCACTGGAATAGCAGGG - Intronic
1077421755 11:2453757-2453779 CTGAAGGCACTGGCAAAGGCAGG + Intronic
1079503759 11:21131957-21131979 CTGGAGACACAGGTACAGGATGG + Intronic
1085068950 11:73523985-73524007 CTCAAAGCACTGGTATAGGTAGG + Intronic
1090224339 11:125060993-125061015 CAGTAGGGACTGGTATTTGATGG + Intergenic
1090674104 11:128973088-128973110 CTGTTGTCTCTGGTAGAGGATGG + Exonic
1093236664 12:16617140-16617162 CTGTAGTCACTGATATAAAATGG - Intergenic
1094187524 12:27661094-27661116 CTGTATGCACAGGAATAGGGAGG + Intronic
1096828157 12:54294999-54295021 CTCCAGGCACTGGGAAAGGAAGG - Intronic
1100654905 12:96632796-96632818 ATGTATGTATTGGTATAGGAAGG + Intronic
1106068938 13:26387941-26387963 ATGTAGGCACTGGTTTACAACGG - Intronic
1106270326 13:28146643-28146665 CTTTAGGCAGTGGTATACAAAGG + Intronic
1106805452 13:33301945-33301967 CTGCAGGCACAAGTATATGAAGG - Intronic
1108729781 13:53222870-53222892 CTGTTGTCTCTGATATAGGATGG + Intergenic
1109376258 13:61497007-61497029 CTGTATGCACTGGTATAAAATGG - Intergenic
1115075400 14:29383626-29383648 CCCTAGGCACTGGTAATGGATGG + Intergenic
1118584134 14:67335979-67336001 CTGTTGGCACAGGTATAGGTAGG + Intronic
1122343371 14:101043230-101043252 CTGGAGGCAGTGGGAGAGGAGGG + Intergenic
1124821502 15:33050901-33050923 CTGTATGCACTGACATAGAAAGG + Intronic
1130973043 15:88749593-88749615 CTGGAGGCCTTGCTATAGGAGGG - Intergenic
1131154855 15:90068432-90068454 CTCGAGGCACTGGTAGAGGGTGG - Exonic
1131390507 15:92044211-92044233 TTGTGGGCACTGAGATAGGAGGG - Intronic
1134811463 16:17170542-17170564 CTCTAGGCAAAGGTGTAGGAAGG - Intronic
1136300874 16:29333664-29333686 CTGTAGGCACTGGGACGGGGAGG - Intergenic
1139208529 16:65053061-65053083 CCGTAGGCACTTGGATAAGAAGG + Intronic
1147174740 17:38647848-38647870 CTGTAGGGACAGGTTTGGGATGG + Intergenic
1147417857 17:40306695-40306717 CTGTAGGCAAGGGTTTAGGGAGG + Intergenic
1149622629 17:58057495-58057517 CTGTAGGCTCAGGAACAGGAAGG + Intergenic
1152471622 17:80492723-80492745 CTGTAGGCACTGGGTCTGGAGGG - Intergenic
1153514745 18:5892853-5892875 CTGTAGGAACAGGCATAGGTGGG - Intronic
1159308186 18:66673137-66673159 CTGTAGGCAATGGTAAATAATGG - Intergenic
1162341494 19:10093881-10093903 CTGTGGGCACAGGGATAGGGGGG + Intronic
1167548631 19:50144256-50144278 CTGTTGTCACTGGTATGGAATGG - Intergenic
927952040 2:27177572-27177594 CTGTAGTCCCAGGTACAGGAGGG - Intergenic
928090437 2:28370568-28370590 CTGTAGGCAAGGGTACTGGATGG - Intergenic
928140477 2:28724161-28724183 CTGGAGGCAATGGAATAGGAAGG + Intergenic
936236194 2:110744723-110744745 CTGTAGTCAATGAAATAGGAGGG + Intronic
944466982 2:200011636-200011658 CTATTGGCAATGGTAAAGGAAGG - Intergenic
1168837259 20:885457-885479 CTGTAGGCACAGATTGAGGAGGG + Intronic
1169064988 20:2690122-2690144 CTGTGGGCACTGGGGTAGGGAGG + Intergenic
1169381396 20:5110600-5110622 CTGGAGGCACTAGTATAGCCAGG - Intronic
1169763224 20:9120094-9120116 CTGTGGGCACTGCTCTAAGAAGG + Intronic
1173320211 20:41980941-41980963 CTCTAGCAGCTGGTATAGGAGGG + Intergenic
1178709605 21:34903694-34903716 CTATAGGCACTCGGATAAGATGG + Intronic
1184506440 22:44906608-44906630 CTGTAGGCCCTGGGACAGGAGGG + Intronic
949767003 3:7537659-7537681 GTGCAGGCACTGGGTTAGGAGGG + Intronic
956050180 3:65239697-65239719 ATGTAGGCACTGGCATTGCATGG + Intergenic
961442846 3:126962946-126962968 CTGTGGTCCCTGGTATAGGCAGG + Intergenic
963808273 3:149748409-149748431 CTGTAAACACTGGGATAGCAGGG - Intronic
963882909 3:150548003-150548025 CTGTAGGCATTTTTAAAGGAGGG - Intronic
964820376 3:160762328-160762350 CTTTAAGCACAGGCATAGGAAGG - Intronic
966227666 3:177615355-177615377 CTATTGGAACTGGTATAGAAAGG + Intergenic
967715221 3:192754694-192754716 CTGCAGGTTCTGGTATAGGATGG - Intronic
967866148 3:194191670-194191692 CTGTAAGCAGAGCTATAGGATGG + Intergenic
971321913 4:25612521-25612543 CAGTAGGCACTATTATAAGATGG + Intergenic
976089026 4:81435899-81435921 CTGTAGTCCCAGGTATAGGAGGG - Intronic
977272652 4:94937089-94937111 CTGTAAGTACAGGTATAGAAAGG - Intronic
977803416 4:101266682-101266704 CTGTATGGACTGGTCTAGTATGG - Intronic
983959818 4:173738862-173738884 CTGTTGGAAGTGCTATAGGAAGG - Intergenic
984052684 4:174886003-174886025 TTGTAGTCACTGGAATAGGCAGG - Intronic
984145141 4:176051293-176051315 CTCAAGGAACTGATATAGGAAGG - Intergenic
987356955 5:17072041-17072063 GTGTAGGCAGTGGTATAGACAGG + Intronic
988503034 5:31799286-31799308 CTGCAGCCACTGGTAGAGGAGGG - Exonic
992473081 5:77077114-77077136 CTGAAGGCATTGGCATTGGACGG + Exonic
993516264 5:88839094-88839116 CTGTAGGCTCTGATAGAGCAAGG - Intronic
998192621 5:140040289-140040311 CTGCAATCACTGGTAAAGGAAGG - Intronic
999111532 5:149125631-149125653 CGGCAGGCACTGGTATGGGATGG - Intergenic
1001066406 5:168538237-168538259 CTGGAGGCAGTGGGATGGGAAGG - Intergenic
1001574309 5:172751924-172751946 CTGTAGGCACTGGTAGGGCAGGG - Intergenic
1002356660 5:178635180-178635202 CTGGAGGCACTCGAATAGCATGG - Intergenic
1003194571 6:3903357-3903379 TTGTAGGCATTGGTATGGCATGG - Intergenic
1005607753 6:27492362-27492384 CTCTAGCCTCTGGTCTAGGAAGG - Intergenic
1005891582 6:30144590-30144612 CAGAAGGCACAGGTCTAGGAAGG + Intronic
1006936993 6:37725485-37725507 CTGTAGGCACTGCAGTACGAGGG + Intergenic
1008999749 6:57699862-57699884 CTGTAGGAACAGGTTGAGGAGGG + Intergenic
1015074805 6:129143000-129143022 CTGTTGGCACGGATAAAGGAAGG - Intronic
1015861952 6:137690683-137690705 CTGTAAGCACTGTTCTAAGAGGG - Intergenic
1016712225 6:147186765-147186787 CTTTTGATACTGGTATAGGAAGG - Intergenic
1018406837 6:163494296-163494318 CTCAAGTCACTGATATAGGAAGG - Intronic
1020639286 7:10735445-10735467 CTGTATCCACTGTTATAAGAAGG - Intergenic
1021457705 7:20847570-20847592 CAGTAGACACTGCTATTGGAAGG + Intergenic
1022513877 7:30963436-30963458 CTGTAAGCACTGGCATGGGCTGG - Intronic
1026145424 7:67742441-67742463 GTGTAAGCCCTGGTACAGGATGG + Intergenic
1031268055 7:119607470-119607492 CTGAAGACACTGGGGTAGGATGG + Intergenic
1032215187 7:129952364-129952386 CCGTAGGCACTGGGGGAGGAGGG + Intronic
1040521549 8:48180593-48180615 CTGCAGGCTCAGGTAGAGGAAGG - Intergenic
1041188244 8:55325273-55325295 CTATAGGCAAATGTATAGGAGGG - Intronic
1044190166 8:89306560-89306582 CTGTAGACACTGATTTGGGAGGG - Intergenic
1044490555 8:92809242-92809264 CTGAAGGCACAGGCACAGGATGG + Intergenic
1045089403 8:98725160-98725182 CTATATGTACTGGTATGGGAAGG + Intronic
1045714710 8:105027656-105027678 TAGGAAGCACTGGTATAGGAGGG - Intronic
1045818895 8:106311700-106311722 TTGAAGGCAGTGGTATAGGTAGG - Intronic
1052600952 9:30629904-30629926 CTATAGTCATTGATATAGGAGGG - Intergenic
1055702516 9:78961137-78961159 CTGTAGGCTCTGTAATAGCAAGG + Intergenic
1056458728 9:86788760-86788782 CTGTAAGGGCTGGTATAAGAAGG - Intergenic
1057461209 9:95263858-95263880 CTGTAGGAACAGGTATATTATGG + Intronic
1057666517 9:97050074-97050096 CTGTAGGCCCAGCTATAGGGAGG + Intergenic
1058393130 9:104520181-104520203 CTGGTGGCACAGGTATTGGAGGG - Intergenic
1062104590 9:134746679-134746701 CTGAAGGCCCTGGCACAGGAGGG - Intronic
1203775541 EBV:71160-71182 CTGTAGGAACGGGTCTTGGATGG + Intergenic
1203786355 EBV:130086-130108 CTTTGGGCACTGGTTAAGGATGG + Intergenic
1187172150 X:16862503-16862525 CTGTAGGCACTGGTATAGGAAGG - Intronic
1192318450 X:70068881-70068903 CTGTAGTCATTGTTATAGAATGG - Intergenic