ID: 1187173072

View in Genome Browser
Species Human (GRCh38)
Location X:16870333-16870355
Sequence GAGCGCAGGCGCATCCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 80}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187173066_1187173072 -4 Left 1187173066 X:16870314-16870336 CCAGCCCGCCCAGGCAGCTGAGC 0: 1
1: 1
2: 1
3: 44
4: 397
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173062_1187173072 5 Left 1187173062 X:16870305-16870327 CCGCGCCTCCCAGCCCGCCCAGG 0: 1
1: 0
2: 10
3: 68
4: 779
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173068_1187173072 -9 Left 1187173068 X:16870319-16870341 CCGCCCAGGCAGCTGAGCGCAGG 0: 1
1: 0
2: 4
3: 32
4: 305
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173065_1187173072 -3 Left 1187173065 X:16870313-16870335 CCCAGCCCGCCCAGGCAGCTGAG 0: 1
1: 0
2: 2
3: 25
4: 388
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173067_1187173072 -8 Left 1187173067 X:16870318-16870340 CCCGCCCAGGCAGCTGAGCGCAG 0: 1
1: 0
2: 4
3: 32
4: 346
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173061_1187173072 6 Left 1187173061 X:16870304-16870326 CCCGCGCCTCCCAGCCCGCCCAG 0: 1
1: 1
2: 3
3: 102
4: 796
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80
1187173064_1187173072 0 Left 1187173064 X:16870310-16870332 CCTCCCAGCCCGCCCAGGCAGCT 0: 1
1: 0
2: 4
3: 55
4: 848
Right 1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG 0: 1
1: 0
2: 0
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187173072 Original CRISPR GAGCGCAGGCGCATCCGCCC TGG Intronic
900483499 1:2910609-2910631 GGGTGCAGGAGCATCAGCCCAGG + Intergenic
901453501 1:9350465-9350487 GAGAGCAGGCGCCGCCGGCCAGG + Intronic
902793363 1:18784252-18784274 GCGCTCAGGCGCATCTGGCCCGG - Intergenic
914919561 1:151838277-151838299 AGGCGCAGCCGCAGCCGCCCGGG + Exonic
916738797 1:167630491-167630513 CAGGGCAGGGGCAGCCGCCCGGG - Intronic
921158033 1:212453256-212453278 GGGCGCAGGGGCAGCAGCCCAGG - Intergenic
1067272636 10:44805387-44805409 GAGCACAGGCCCCTCCGACCTGG - Intergenic
1073325852 10:102643756-102643778 GAGCGCAGAAGTAGCCGCCCGGG + Intergenic
1074553996 10:114471490-114471512 AAGCGCAGGTGCATTGGCCCGGG - Intronic
1075086269 10:119416294-119416316 GAGAGCAGGTGCAGCCGCCTTGG + Intronic
1075112233 10:119596709-119596731 GAGCGCAGGCGCGACCCGCCAGG + Intronic
1083477149 11:62921935-62921957 GAGGGCTGGCGCACCCGCCCGGG + Intergenic
1084014697 11:66371597-66371619 CACCCCAGGCGCATCCGCCGCGG - Exonic
1085666222 11:78417621-78417643 GAGTGCGGGCGCGGCCGCCCAGG - Intronic
1090619489 11:128548761-128548783 GGGCGCAGGCGAAGCCGGCCCGG - Intronic
1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG + Exonic
1102480711 12:113221462-113221484 GAGAGCTGGCGCAGCTGCCCTGG + Exonic
1102959848 12:117085384-117085406 GACAGCAGGTGCAGCCGCCCAGG + Intronic
1105440906 13:20415062-20415084 GAGGGCAGGCGGGCCCGCCCAGG - Intronic
1106408669 13:29496152-29496174 CAGTGCAGGTGCATCTGCCCTGG + Intronic
1107364446 13:39655619-39655641 CCGCGCATGCGCATCGGCCCCGG - Intronic
1121358046 14:93231471-93231493 GAGCCCAGTCCCATCAGCCCCGG + Intergenic
1122797300 14:104212474-104212496 GAGCGCAGGTCCATGCACCCTGG + Intergenic
1124663439 15:31569979-31570001 GAGCCTAGGCACAGCCGCCCAGG - Intronic
1125606285 15:40941673-40941695 GAGGGAGGGCGCAGCCGCCCAGG - Intergenic
1129698940 15:77756588-77756610 GAGCCCAGGCTCAGCAGCCCTGG + Intronic
1130076676 15:80695579-80695601 CGGCGCCGGCGCGTCCGCCCCGG + Exonic
1131263505 15:90902590-90902612 GTGCGCAGCCGCACCAGCCCGGG - Intronic
1133008871 16:2899154-2899176 GACAACAGGCGCATCCTCCCAGG + Exonic
1142137435 16:88458139-88458161 GAGCGCAGGCCCGGCCGCCTGGG - Intronic
1142764646 17:2058371-2058393 GAGCACATGCGCATCCACTCGGG + Exonic
1144339750 17:14301693-14301715 GAGCCCAGGAGCAGCAGCCCCGG - Exonic
1150108340 17:62478399-62478421 CAGCGCCGGCCCAACCGCCCCGG + Intronic
1150562142 17:66303085-66303107 GCGCTCCGGCGCGTCCGCCCCGG + Intronic
1151886835 17:76927657-76927679 AAGGGCAGGCCCATGCGCCCGGG - Intronic
1152352585 17:79791807-79791829 GACCTCAGGCGCATCCTCCCGGG + Intergenic
1153625827 18:7021205-7021227 GCGGGCAGGCCCATCAGCCCAGG - Intronic
1157744272 18:50121011-50121033 GAGAGCAGGTGCATCTGCACTGG - Intronic
1157752727 18:50193916-50193938 GAACGCGGGCGTCTCCGCCCGGG + Intronic
1161057588 19:2198425-2198447 GAGGGCAGGGCCACCCGCCCCGG - Intronic
1161065727 19:2236355-2236377 GTGCGCAGGCGCACTAGCCCTGG - Exonic
1161443277 19:4304579-4304601 TTGCGCAGGCGCACCCGCCGCGG - Exonic
1168474182 19:56664210-56664232 GAGCACCGGCGCATCCACACAGG - Exonic
928158054 2:28894640-28894662 GTGCGCAGGCGCACCGGCGCGGG - Exonic
937321452 2:120963455-120963477 GCGCGCACGCGCATCCACCTGGG + Intronic
938549909 2:132370559-132370581 GAGCCCAGGGGCACTCGCCCAGG - Intergenic
944495879 2:200306891-200306913 GAGCGCCGGCTCCTCCGTCCCGG - Intronic
945319615 2:208406695-208406717 GAGCGCGAGCGCAGCCGCGCGGG + Intronic
946362766 2:219229144-219229166 GAGCCCAGGCCCAGCCGGCCGGG - Exonic
1172109411 20:32536521-32536543 CGGCGCAGGCGCGTGCGCCCCGG + Intronic
1173243507 20:41317879-41317901 GAGTGCTGGCGCATGCGCCGGGG - Intergenic
1173553482 20:43949319-43949341 GACCGCAGGAGCCTCCTCCCAGG + Intronic
1179891535 21:44338255-44338277 GAGAGCAGACGCTTCCTCCCAGG - Intronic
1180165448 21:46023357-46023379 GAGCGCGGACGCGTCCGCACAGG - Intergenic
1181079738 22:20405910-20405932 GAGCACCGGCGCATCCACACCGG + Exonic
1184712790 22:46262993-46263015 GAGCGCGGGCGCGGCCGGCCAGG + Exonic
950563193 3:13747949-13747971 GAGGGCAGGCGCTTCCCCCAGGG - Intergenic
952970901 3:38649611-38649633 GGGCGCAGGCTCAGCGGCCCCGG + Exonic
962588070 3:136862187-136862209 GTGGGCAGGCGGATCCGCGCGGG - Exonic
968457136 4:705664-705686 GGGCGCAGGCGCGTCGGGCCTGG - Intergenic
970081557 4:12292513-12292535 GAGCCCAGGGGCACTCGCCCTGG + Intergenic
972479018 4:39480372-39480394 GGGCGTCGGCGCATCCTCCCTGG - Intergenic
975041057 4:69744287-69744309 CAGCGGAGGCGCAGCGGCCCTGG + Intronic
989178989 5:38557144-38557166 GAGCGGCGGCGCCTCGGCCCTGG - Intronic
989441087 5:41473516-41473538 GAGCGCAGGCTCCGCCTCCCAGG + Intronic
1014078748 6:117265548-117265570 GAGCTCAGGCGCTTCTGCCCTGG + Intronic
1014632398 6:123803426-123803448 GACCGCAGGGGCTGCCGCCCAGG - Intergenic
1016940861 6:149482014-149482036 GGGCGCAGGGACAGCCGCCCAGG + Intronic
1019535823 7:1529590-1529612 GAGCGCGGGGGCAGCCTCCCGGG - Intergenic
1019618999 7:1980384-1980406 GAGAGGAGGCGGATACGCCCAGG - Intronic
1019649232 7:2147632-2147654 GAGAGCTGGGGCACCCGCCCTGG - Intronic
1029110884 7:98212472-98212494 GAGGGCAGGCGCAGGCGGCCAGG + Exonic
1029706701 7:102280146-102280168 GAGGGGAGGGGCATCAGCCCAGG + Intronic
1029736700 7:102469304-102469326 GGGGGCAGGGGCATCCCCCCAGG - Intronic
1032037383 7:128530933-128530955 CAGCGCCGGCCCAACCGCCCCGG + Intergenic
1043502980 8:80874402-80874424 GCGCGCGGGCGCAGCCGGCCGGG - Intronic
1045516551 8:102864709-102864731 GAGGGCGGGCGCCTCAGCCCGGG - Exonic
1048878823 8:138857098-138857120 GAGTGCAGGCGGATCCAGCCTGG - Intronic
1049800885 8:144517102-144517124 GAGCCCTGGCGGCTCCGCCCTGG + Exonic
1062230622 9:135479863-135479885 GGGCGCAGGGGCGTCCGGCCGGG - Exonic
1062341582 9:136095793-136095815 GCGCGCATCCGCAGCCGCCCTGG + Intergenic
1185468789 X:370557-370579 AAGCTCAGGAGCATCCGCCAGGG - Intronic
1187173072 X:16870333-16870355 GAGCGCAGGCGCATCCGCCCTGG + Intronic
1196180110 X:112680193-112680215 GAGCGCGCGCGCATGCGCGCAGG + Intergenic