ID: 1187173296

View in Genome Browser
Species Human (GRCh38)
Location X:16871225-16871247
Sequence CAGCTCCGCCAGCTTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187173296_1187173305 4 Left 1187173296 X:16871225-16871247 CCCACCCCAAGCTGGCGGAGCTG No data
Right 1187173305 X:16871252-16871274 GAGCAGGGCTGAACTACCCTGGG No data
1187173296_1187173304 3 Left 1187173296 X:16871225-16871247 CCCACCCCAAGCTGGCGGAGCTG No data
Right 1187173304 X:16871251-16871273 AGAGCAGGGCTGAACTACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187173296 Original CRISPR CAGCTCCGCCAGCTTGGGGT GGG (reversed) Intergenic
No off target data available for this crispr