ID: 1187175049

View in Genome Browser
Species Human (GRCh38)
Location X:16888693-16888715
Sequence GCCTTGCCTCCCCTGCCTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187175049_1187175057 13 Left 1187175049 X:16888693-16888715 CCCCGAGGCAGGGGAGGCAAGGC No data
Right 1187175057 X:16888729-16888751 TTGTTCTGTTTTTGAAGGACTGG No data
1187175049_1187175056 8 Left 1187175049 X:16888693-16888715 CCCCGAGGCAGGGGAGGCAAGGC No data
Right 1187175056 X:16888724-16888746 TGGGCTTGTTCTGTTTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187175049 Original CRISPR GCCTTGCCTCCCCTGCCTCG GGG (reversed) Intergenic
No off target data available for this crispr