ID: 1187180244

View in Genome Browser
Species Human (GRCh38)
Location X:16937082-16937104
Sequence CTTTCCTTAGAGAAGAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187180241_1187180244 -7 Left 1187180241 X:16937066-16937088 CCCTTTCATCACTTCTCTTTCCT No data
Right 1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG No data
1187180240_1187180244 15 Left 1187180240 X:16937044-16937066 CCAAGAATGATCAATTTCTTCTC No data
Right 1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG No data
1187180242_1187180244 -8 Left 1187180242 X:16937067-16937089 CCTTTCATCACTTCTCTTTCCTT No data
Right 1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187180244 Original CRISPR CTTTCCTTAGAGAAGAGTGA GGG Intergenic
No off target data available for this crispr