ID: 1187181457

View in Genome Browser
Species Human (GRCh38)
Location X:16946977-16946999
Sequence GGCACAGCGCGCGAAGAGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1187181457_1187181467 1 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181467 X:16947001-16947023 GCGCCGCGGGCGGGGGCCCCGGG 0: 1
1: 1
2: 11
3: 83
4: 645
1187181457_1187181466 0 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181466 X:16947000-16947022 GGCGCCGCGGGCGGGGGCCCCGG 0: 1
1: 1
2: 11
3: 136
4: 1066
1187181457_1187181462 -8 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181462 X:16946992-16947014 GCTGTGCCGGCGCCGCGGGCGGG 0: 1
1: 0
2: 5
3: 35
4: 264
1187181457_1187181470 7 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181470 X:16947007-16947029 CGGGCGGGGGCCCCGGGTCTGGG 0: 1
1: 0
2: 2
3: 31
4: 316
1187181457_1187181472 17 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181472 X:16947017-16947039 CCCCGGGTCTGGGCCCCCCGAGG 0: 1
1: 0
2: 2
3: 24
4: 268
1187181457_1187181469 6 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181469 X:16947006-16947028 GCGGGCGGGGGCCCCGGGTCTGG 0: 1
1: 0
2: 5
3: 80
4: 606
1187181457_1187181464 -6 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181464 X:16946994-16947016 TGTGCCGGCGCCGCGGGCGGGGG 0: 1
1: 0
2: 0
3: 30
4: 267
1187181457_1187181463 -7 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181463 X:16946993-16947015 CTGTGCCGGCGCCGCGGGCGGGG 0: 1
1: 0
2: 3
3: 29
4: 236
1187181457_1187181461 -9 Left 1187181457 X:16946977-16946999 CCGAGCTCTTCGCGCGCTGTGCC 0: 1
1: 0
2: 1
3: 6
4: 73
Right 1187181461 X:16946991-16947013 CGCTGTGCCGGCGCCGCGGGCGG 0: 1
1: 0
2: 2
3: 13
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1187181457 Original CRISPR GGCACAGCGCGCGAAGAGCT CGG (reversed) Exonic
901738538 1:11327572-11327594 GGCACTGAGTGGGAAGAGCTGGG + Intergenic
907010661 1:50959964-50959986 GGGGCAGCGCGGGAAGCGCTAGG + Exonic
914332556 1:146685775-146685797 GGCACAGAAGGGGAAGAGCTTGG + Intergenic
916551951 1:165858329-165858351 GGCACAGGGCATGAAGAGGTTGG - Intronic
1073137583 10:101228440-101228462 GGCACAGGGCGCGAGGCGCTGGG + Intronic
1075239462 10:120764877-120764899 GGCCCAGCGCTGGTAGAGCTGGG + Intergenic
1075592643 10:123703654-123703676 GGCAGAGGGAGGGAAGAGCTCGG + Intergenic
1077514840 11:2995256-2995278 GGCACAGCTCGCCAAGTGCCAGG - Intergenic
1080668654 11:34357317-34357339 CGGACAGCGCGAGAAGAGGTCGG + Exonic
1084729101 11:71061844-71061866 GGCAGAGCGGGGGAAGGGCTAGG - Intronic
1086362020 11:86069206-86069228 CGCTCAGCGAGGGAAGAGCTGGG + Intronic
1087046054 11:93844846-93844868 GGAACAGCTTGCCAAGAGCTGGG - Intronic
1088522345 11:110712757-110712779 GGCACGGCGCGGGAAGGGATGGG - Intronic
1090015939 11:123086656-123086678 GGCACAGATGGGGAAGAGCTAGG + Intronic
1101340900 12:103841215-103841237 GGCAGAGCGCGGGTAGATCTTGG - Intergenic
1112407956 13:99137448-99137470 GGGACTGAGAGCGAAGAGCTGGG - Intergenic
1118030254 14:61812262-61812284 AGCAAAGCGGGAGAAGAGCTAGG - Intergenic
1121441170 14:93950422-93950444 GGCAAAGAGGGCAAAGAGCTGGG + Intronic
1122790165 14:104181010-104181032 GGCACAGCACCCGAAGCCCTGGG - Intergenic
1128380427 15:67107978-67108000 GGCACAGCGCGGGAGGTGGTGGG - Intronic
1129454535 15:75669722-75669744 GGCACAGCGCCCCATGAGCCTGG + Intergenic
1130891757 15:88139388-88139410 GGCACACCGCACTAAGACCTAGG + Intronic
1132738966 16:1401503-1401525 GGCACAGCGCGAGAACAGCTCGG - Intronic
1139506285 16:67399639-67399661 GGCAGCGCTCCCGAAGAGCTGGG + Intronic
1140001058 16:71025466-71025488 GGCACAGAAGGGGAAGAGCTTGG - Exonic
1142163393 16:88570803-88570825 GAGGCAGCGCGCGAGGAGCTCGG - Intronic
1147501780 17:40972497-40972519 GGAACAGGGCAGGAAGAGCTTGG - Intergenic
1148857767 17:50588331-50588353 GTCACAGGGCAGGAAGAGCTGGG - Intronic
1149263146 17:54900689-54900711 GGCACCGAGCGTGAGGAGCTGGG - Exonic
1151073401 17:71244051-71244073 GATACAGCTAGCGAAGAGCTGGG + Intergenic
1152916579 17:83039825-83039847 GGCACTGCAGGAGAAGAGCTGGG + Intronic
1154411215 18:14143216-14143238 GGCCCAGAGCCCCAAGAGCTGGG + Intergenic
1160040434 18:75340133-75340155 GGCACAGCGAGCGATGGGCAAGG - Intergenic
1160844231 19:1159563-1159585 GGGACAGCGGGGGAAGAGCAGGG + Intronic
1164400860 19:27901309-27901331 GGCACAGCGAGTGCAGAGCCTGG + Intergenic
937217680 2:120323085-120323107 GGCAGAGCTGGCGAGGAGCTAGG - Intergenic
946647346 2:221852043-221852065 GGCAGAGGGTGAGAAGAGCTAGG - Intergenic
948237854 2:236403843-236403865 GGCACAGCGAGCGAGGATCGGGG - Intronic
1172347591 20:34216034-34216056 GGCGCAGCTCGCAGAGAGCTGGG + Intronic
1173809698 20:45948331-45948353 CCCACAGTGAGCGAAGAGCTGGG + Intergenic
1176861841 21:14015201-14015223 GGCCCAGAGCCCCAAGAGCTGGG - Intergenic
1180997724 22:19973753-19973775 GCCACAGTGCGCAAAGAGCGCGG - Exonic
1184697269 22:46147101-46147123 GGCACAAAGCGGGCAGAGCTGGG - Intergenic
1185367004 22:50441377-50441399 GGCCCAGAGCCCCAAGAGCTGGG - Intronic
950617680 3:14175119-14175141 GACACAGCGAGCGAGGGGCTGGG - Intronic
961202463 3:125055761-125055783 GGCTCAGCGCGCGGCGAGCCGGG + Exonic
964041783 3:152269337-152269359 GGCACAGCCCGCGCACGGCTTGG + Intronic
966866688 3:184262005-184262027 CCCACAGCGCGGGAAGAGCTCGG + Intronic
967227442 3:187305541-187305563 GGCACAGTGAGCGCAGAGCCTGG + Intergenic
975622387 4:76307440-76307462 CGCACAGCCCATGAAGAGCTGGG + Intronic
997752295 5:136357912-136357934 GGCACAGCCCTTGGAGAGCTGGG - Intronic
1005639372 6:27781392-27781414 GGCACACAGCTCCAAGAGCTTGG - Intergenic
1005954338 6:30653246-30653268 GGCAAAACACGAGAAGAGCTAGG - Exonic
1007897381 6:45377369-45377391 GGCACGGCGAGAGAAGAGTTAGG - Intronic
1020111032 7:5447900-5447922 GGCACAGGGCGGGATGAGGTGGG - Intronic
1020274245 7:6615359-6615381 GGCACAGCGCGCGCTGCGCTCGG + Intergenic
1023638305 7:42235822-42235844 GGAACAGCTGGCAAAGAGCTGGG + Intronic
1026945326 7:74312560-74312582 GGCACAGCTCTCCGAGAGCTTGG - Intronic
1032262248 7:130347112-130347134 GACACAGCGAGCGTAGAGATGGG + Intronic
1039936762 8:42052139-42052161 GGCCGAGAGCGGGAAGAGCTGGG + Intergenic
1040555788 8:48476545-48476567 GAGACAGCGCACGAAGAGCTTGG - Intergenic
1040750385 8:50698664-50698686 TGCACAGCTTGCAAAGAGCTAGG + Intronic
1041446378 8:57955363-57955385 GCCTCAGCCCCCGAAGAGCTGGG + Intergenic
1049060569 8:140273216-140273238 GGCACAGCCTGTGAAGAGGTTGG - Intronic
1049427659 8:142544557-142544579 GGCACAGGGCCCGCAGTGCTGGG + Exonic
1049749816 8:144277775-144277797 GGCCCAGCGCCCGAAGGGCAGGG + Intronic
1060531012 9:124346997-124347019 GACACAGCGAGTGCAGAGCTGGG + Intronic
1061579753 9:131529784-131529806 GGCACAGCCCGAGAACAGCAAGG - Intronic
1062069692 9:134548871-134548893 GGGACATCGCGCGCAGAGCCAGG + Intergenic
1187181457 X:16946977-16946999 GGCACAGCGCGCGAAGAGCTCGG - Exonic
1200684402 Y:6246220-6246242 GGGACTGCGCGCGAAGAGCCGGG - Intronic
1200687046 Y:6266544-6266566 GGGACTGCGCGCGAAGAGCCGGG - Intergenic
1200989924 Y:9337461-9337483 GGGACTGCGCGCGAAGGGCCGGG - Intronic
1200992593 Y:9357794-9357816 GGGACTGCGCGCGAAGGGCCGGG - Intronic
1200995246 Y:9378073-9378095 GGGACTGCGCGCGAAGGGCCGGG - Intronic
1200997910 Y:9398418-9398440 GGGACTGCGCGCGAAGGGCCGGG - Intronic
1201000419 Y:9466952-9466974 GGGACTGCGCGCGAAGGGCCGGG - Exonic
1201003081 Y:9487264-9487286 GGGACTGCGCGCGAAGGGCCGGG - Exonic
1201005740 Y:9507547-9507569 GGGACTGCGCGCGAAGGGCCGGG - Intergenic
1201008400 Y:9527877-9527899 GGGACTGCGCGCGAAGGGCCGGG - Intronic
1201048231 Y:9908166-9908188 GGGACTGCGCGCGAAGGGCCGGG + Intergenic